Incidental Mutation 'R6482:Acadvl'
ID 517172
Institutional Source Beutler Lab
Gene Symbol Acadvl
Ensembl Gene ENSMUSG00000018574
Gene Name acyl-Coenzyme A dehydrogenase, very long chain
Synonyms VLCAD
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock # R6482 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 70010183-70015411 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70011562 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 415 (I415V)
Ref Sequence ENSEMBL: ENSMUSP00000018718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018718] [ENSMUST00000019362] [ENSMUST00000102574] [ENSMUST00000102575] [ENSMUST00000190940]
AlphaFold P50544
Predicted Effect probably benign
Transcript: ENSMUST00000018718
AA Change: I415V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000018718
Gene: ENSMUSG00000018574
AA Change: I415V

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 74 188 4.4e-22 PFAM
Pfam:Acyl-CoA_dh_M 192 245 5.1e-20 PFAM
Pfam:Acyl-CoA_dh_1 306 455 6.7e-41 PFAM
Pfam:Acyl-CoA_dh_2 321 445 2.8e-12 PFAM
Blast:HisKA 460 557 6e-10 BLAST
low complexity region 558 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019362
SMART Domains Protein: ENSMUSP00000019362
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
Pfam:Dishevelled 103 263 1.5e-60 PFAM
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083600
Predicted Effect probably benign
Transcript: ENSMUST00000102574
AA Change: I437V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099634
Gene: ENSMUSG00000018574
AA Change: I437V

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 96 210 2.5e-25 PFAM
Pfam:Acyl-CoA_dh_M 214 316 5.5e-25 PFAM
Pfam:Acyl-CoA_dh_1 328 477 2.5e-41 PFAM
Pfam:Acyl-CoA_dh_2 343 467 8.7e-14 PFAM
Blast:HisKA 482 579 7e-10 BLAST
low complexity region 580 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102575
SMART Domains Protein: ENSMUSP00000099635
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156733
Predicted Effect probably benign
Transcript: ENSMUST00000190940
SMART Domains Protein: ENSMUSP00000140073
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152732
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a homodimeric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C16- and C20-acylCoA and localizes to the inner mitochondrial membrane (unlike related acyl-CoA dehydrogenases). In mice, deficiency of this gene can cause ventricular arrhythmias as well as fasting and cold intolerance. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutant animals exhibit mild steatosis, lipid accumulation in myocytes, increased fatigue, impaired temperature regulation, increased susceptibility to arrhythmia, accumulation of long-chain acylcarnitines, and lower free carnitine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Acadvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03391:Acadvl APN 11 70010716 missense probably damaging 0.99
IGL03396:Acadvl APN 11 70011413 nonsense probably null
R1122:Acadvl UTSW 11 70011377 missense probably damaging 1.00
R1271:Acadvl UTSW 11 70014700 missense probably damaging 1.00
R1435:Acadvl UTSW 11 70014816 missense probably benign 0.00
R1519:Acadvl UTSW 11 70014791 critical splice donor site probably null
R1710:Acadvl UTSW 11 70010355 missense probably damaging 1.00
R1853:Acadvl UTSW 11 70010870 missense probably damaging 1.00
R4747:Acadvl UTSW 11 70012508 missense probably damaging 1.00
R4822:Acadvl UTSW 11 70011184 missense probably benign 0.01
R5700:Acadvl UTSW 11 70013203 missense probably damaging 0.99
R6312:Acadvl UTSW 11 70011767 missense probably damaging 0.99
R6489:Acadvl UTSW 11 70010319 missense probably benign 0.00
R6904:Acadvl UTSW 11 70014333 missense probably benign 0.31
R7009:Acadvl UTSW 11 70014791 critical splice donor site probably null
R7623:Acadvl UTSW 11 70010743 missense probably damaging 1.00
R8103:Acadvl UTSW 11 70014342 missense probably benign 0.00
R8439:Acadvl UTSW 11 70011728 nonsense probably null
R8556:Acadvl UTSW 11 70013550 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCATACAGCCTTGCAGAGC -3'
(R):5'- CATGGACCAGGGATTCAAAGAC -3'

Sequencing Primer
(F):5'- AGTCGAAGAATGTCATTTGCCCC -3'
(R):5'- CCAGGGATTCAAAGACTTCCAGATAG -3'
Posted On 2018-05-21