Mutagenetix > Incidental Mutation

Incidental Mutation 'R6482:Plekhg3'

517174

Institutional Source

Beutler Lab

Gene Symbol

Plekhg3

Ensembl Gene

ENSMUSG00000052609

Gene Name

pleckstrin homology domain containing, family G (with RhoGef domain) member 3

Synonyms

MGC40768

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6482 (G1)

Quality Score

165.009

Status

Validated

Chromosome

Chromosomal Location

76530891-76580488 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76576004 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 673 (N673D)

Ref Sequence

ENSEMBL: ENSMUSP00000151851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000075249] [ENSMUST00000219063]

AlphaFold

Q4VAC9

Predicted Effect

probably benign
Transcript: ENSMUST00000021458

SMART Domains

Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061

Domain	Start	End	E-Value	Type
CH	56	156	2.73e-26	SMART
CH	175	273	4.57e-28	SMART
SPEC	305	411	2.71e0	SMART
SPEC	425	525	4.65e-23	SMART
SPEC	531	634	4.51e-21	SMART
SPEC	640	740	3.02e-31	SMART
SPEC	746	845	1.47e-20	SMART
SPEC	851	951	1.04e-20	SMART
SPEC	957	1058	7.22e-20	SMART
SPEC	1064	1165	2.06e-24	SMART
SPEC	1171	1271	3.84e-15	SMART
SPEC	1277	1376	2.22e-20	SMART
SPEC	1382	1475	5.04e-10	SMART
SPEC	1481	1581	3.58e-24	SMART
SPEC	1587	1687	4.11e-24	SMART
SPEC	1693	1794	2.91e-24	SMART
SPEC	1800	1900	7.8e-16	SMART
SPEC	1906	2006	3.16e-25	SMART
SPEC	2012	2193	4.32e-9	SMART
PH	2180	2291	8.98e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000075249
AA Change: N674D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000074729
Gene: ENSMUSG00000052609
AA Change: N674D

Domain	Start	End	E-Value	Type
low complexity region	18	34	N/A	INTRINSIC
RhoGEF	97	271	6.67e-51	SMART
PH	297	396	2.48e-9	SMART
coiled coil region	515	552	N/A	INTRINSIC
low complexity region	563	585	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	727	737	N/A	INTRINSIC
low complexity region	753	766	N/A	INTRINSIC
low complexity region	978	993	N/A	INTRINSIC
low complexity region	1233	1246	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218427

Predicted Effect

probably benign
Transcript: ENSMUST00000219063
AA Change: N673D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219426

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	T	C	11: 70,011,562	I415V	probably benign	Het
Akap8l	A	G	17: 32,345,396	F6L	possibly damaging	Het
Ano3	T	A	2: 110,697,055	N603Y	probably damaging	Het
Casp8ap2	T	C	4: 32,634,813	S116P	probably damaging	Het
Ccdc110	A	T	8: 45,942,788	Q572L	probably benign	Het
Chit1	T	C	1: 134,143,242	S20P	probably damaging	Het
Col22a1	G	A	15: 71,890,489	P107L	possibly damaging	Het
Dpys	T	C	15: 39,841,973	H248R	probably damaging	Het
Dsg2	A	T	18: 20,601,314	K783I	possibly damaging	Het
Efnb2	A	T	8: 8,620,637	V321E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Gm21936	A	G	12: 87,795,795	Y95C	probably damaging	Het
Gm35315	A	T	5: 110,078,089	C495S	possibly damaging	Het
Hrh1	A	G	6: 114,480,763	Q335R	possibly damaging	Het
Il12rb2	A	G	6: 67,356,686	L203P	probably damaging	Het
Itgav	T	C	2: 83,794,270	S735P	probably damaging	Het
Klrg1	G	T	6: 122,271,453	C162*	probably null	Het
Mcc	T	C	18: 44,445,864	S651G	possibly damaging	Het
Nkx2-2	T	A	2: 147,185,976	I15F	probably damaging	Het
Nppa	G	A	4: 148,000,871	V13I	probably benign	Het
Olfr1104	G	C	2: 87,022,525	F6L	probably benign	Het
Pde2a	A	G	7: 101,501,037	N228D	probably benign	Het
Pgpep1l	C	T	7: 68,239,067		probably null	Het
Plxna4	A	G	6: 32,516,737	S315P	probably benign	Het
Psg21	A	T	7: 18,654,739		probably null	Het
Rnf111	T	C	9: 70,429,607	T925A	probably damaging	Het
Rnf219	A	T	14: 104,479,817	C373*	probably null	Het
Spag9	T	C	11: 94,093,502	F734L	possibly damaging	Het
Tarbp1	A	G	8: 126,450,695	V746A	probably benign	Het
Tmtc1	A	G	6: 148,412,745	F119L	probably benign	Het
Ttc21b	A	G	2: 66,226,900	M576T	probably benign	Het
Usp48	T	A	4: 137,634,921	V765E	probably damaging	Het
Vmn1r20	A	G	6: 57,432,108	S140G	probably benign	Het
Vwde	A	G	6: 13,205,844	S235P	probably damaging	Het
Wapl	A	G	14: 34,692,692	S504G	probably benign	Het
Wnt5b	A	T	6: 119,433,612	L289Q	possibly damaging	Het
Zfp142	G	A	1: 74,570,217		probably null	Het
Zfp385b	ATCTTCTTCTTCT	ATCTTCTTCTTCTTCT	2: 77,719,648		probably benign	Het
Zfp948	A	G	17: 21,587,551	H335R	probably benign	Het

Other mutations in Plekhg3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01079:Plekhg3	APN	12	76562278	missense	possibly damaging	0.78
IGL01143:Plekhg3	APN	12	76564982	critical splice donor site	probably null
IGL02079:Plekhg3	APN	12	76560429	missense	probably benign	0.01
IGL02349:Plekhg3	APN	12	76562300	missense	probably damaging	1.00
IGL02442:Plekhg3	APN	12	76578353	missense	probably benign	0.01
IGL02570:Plekhg3	APN	12	76578245	missense	probably benign
flagging	UTSW	12	76560520	critical splice donor site	probably null
R0667_Plekhg3_072	UTSW	12	76576598	missense	probably damaging	1.00
trailing	UTSW	12	76564961	missense	probably benign	0.15
R0344:Plekhg3	UTSW	12	76566266	nonsense	probably null
R0667:Plekhg3	UTSW	12	76576598	missense	probably damaging	1.00
R1269:Plekhg3	UTSW	12	76560469	missense	probably damaging	1.00
R1566:Plekhg3	UTSW	12	76572065	missense	possibly damaging	0.54
R1905:Plekhg3	UTSW	12	76576217	missense	probably benign	0.05
R2885:Plekhg3	UTSW	12	76564961	missense	probably benign	0.15
R2962:Plekhg3	UTSW	12	76572659	critical splice donor site	probably null
R3784:Plekhg3	UTSW	12	76560520	critical splice donor site	probably null
R3941:Plekhg3	UTSW	12	76573359	missense	probably damaging	0.98
R4056:Plekhg3	UTSW	12	76565247	missense	probably damaging	1.00
R4080:Plekhg3	UTSW	12	76577981	missense	probably benign	0.02
R4412:Plekhg3	UTSW	12	76577764	missense	probably damaging	0.96
R4413:Plekhg3	UTSW	12	76577764	missense	probably damaging	0.96
R4704:Plekhg3	UTSW	12	76578238	missense	probably damaging	1.00
R4720:Plekhg3	UTSW	12	76578322	missense	possibly damaging	0.59
R4738:Plekhg3	UTSW	12	76576914	missense	probably damaging	1.00
R4898:Plekhg3	UTSW	12	76564125	missense	probably damaging	1.00
R4994:Plekhg3	UTSW	12	76565537	missense	possibly damaging	0.68
R4999:Plekhg3	UTSW	12	76565247	missense	possibly damaging	0.95
R5484:Plekhg3	UTSW	12	76578400	missense	possibly damaging	0.76
R5591:Plekhg3	UTSW	12	76560292	missense	possibly damaging	0.80
R6019:Plekhg3	UTSW	12	76577941	nonsense	probably null
R6147:Plekhg3	UTSW	12	76565211	missense	probably damaging	0.96
R6272:Plekhg3	UTSW	12	76576845	missense	probably benign	0.00
R7081:Plekhg3	UTSW	12	76578245	missense	probably benign
R7349:Plekhg3	UTSW	12	76564565	missense	probably benign	0.45
R7439:Plekhg3	UTSW	12	76576485	missense	probably damaging	1.00
R7449:Plekhg3	UTSW	12	76566222	missense	probably damaging	0.98
R7879:Plekhg3	UTSW	12	76565569	missense	probably damaging	1.00
R8256:Plekhg3	UTSW	12	76562267	missense	probably damaging	0.98
R8298:Plekhg3	UTSW	12	76577078	missense	probably damaging	1.00
R8492:Plekhg3	UTSW	12	76576016	missense	probably benign
R8886:Plekhg3	UTSW	12	76564974	missense	possibly damaging	0.81
R9090:Plekhg3	UTSW	12	76575920	missense	probably benign
R9117:Plekhg3	UTSW	12	76578131	missense	probably benign
R9220:Plekhg3	UTSW	12	76572065	missense	probably benign	0.18
R9271:Plekhg3	UTSW	12	76575920	missense	probably benign
R9294:Plekhg3	UTSW	12	76562278	missense	possibly damaging	0.78
R9394:Plekhg3	UTSW	12	76577088	missense	probably damaging	0.99
R9468:Plekhg3	UTSW	12	76560235	missense	probably damaging	0.98
R9711:Plekhg3	UTSW	12	76564952	missense	possibly damaging	0.83
R9747:Plekhg3	UTSW	12	76564593	missense	probably damaging	1.00
X0062:Plekhg3	UTSW	12	76573343	missense	possibly damaging	0.89
Z1176:Plekhg3	UTSW	12	76575856	critical splice acceptor site	probably null
Z1177:Plekhg3	UTSW	12	76578328	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATATGTTCTCTGTTGCGCCCTAG -3'
(R):5'- GTGGTGTCCCTAAACCACTG -3'

Sequencing Primer
(F):5'- CCCTAGGTTGAGACAGATCCTGAG -3'
(R):5'- GGTGTCCCTAAACCACTGGATTTG -3'

Posted On

2018-05-21