Incidental Mutation 'R6482:Wapl'
ID517176
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene NameWAPL cohesin release factor
SynonymsA530089A20Rik, Wapal
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6482 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location34673928-34747983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34692692 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 504 (S504G)
Ref Sequence ENSEMBL: ENSMUSP00000087481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
Predicted Effect probably benign
Transcript: ENSMUST00000048263
AA Change: S504G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: S504G

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090027
AA Change: S504G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: S504G

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect probably benign
Transcript: ENSMUST00000169910
AA Change: S504G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: S504G

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- GTTTTGAAGATCATGATGAGACAGG -3'
(R):5'- TGGAACCCTGAACTCACATGC -3'

Sequencing Primer
(F):5'- TCATGATGAGACAGGAGGTGATG -3'
(R):5'- GGAACCCTGAACTCACATGCATATAG -3'
Posted On2018-05-21