Incidental Mutation 'R6482:Rnf219'
ID517177
Institutional Source Beutler Lab
Gene Symbol Rnf219
Ensembl Gene ENSMUSG00000022120
Gene Namering finger protein 219
Synonyms2810449K13Rik, 2610206B13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6482 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location104477536-104522645 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 104479817 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 373 (C373*)
Ref Sequence ENSEMBL: ENSMUSP00000022716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022716]
Predicted Effect probably null
Transcript: ENSMUST00000022716
AA Change: C373*
SMART Domains Protein: ENSMUSP00000022716
Gene: ENSMUSG00000022120
AA Change: C373*

DomainStartEndE-ValueType
RING 18 55 2.78e-3 SMART
coiled coil region 87 129 N/A INTRINSIC
coiled coil region 157 263 N/A INTRINSIC
low complexity region 302 319 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226423
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Rnf219
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Rnf219 APN 14 104479387 nonsense probably null
IGL01731:Rnf219 APN 14 104479302 missense probably damaging 1.00
I2505:Rnf219 UTSW 14 104503449 splice site probably benign
IGL03098:Rnf219 UTSW 14 104478817 missense possibly damaging 0.93
PIT4651001:Rnf219 UTSW 14 104506256 missense probably damaging 0.99
R0047:Rnf219 UTSW 14 104503344 splice site probably null
R0047:Rnf219 UTSW 14 104503344 splice site probably null
R0394:Rnf219 UTSW 14 104478853 missense possibly damaging 0.74
R0608:Rnf219 UTSW 14 104479527 missense probably damaging 1.00
R0727:Rnf219 UTSW 14 104480188 missense probably damaging 1.00
R1109:Rnf219 UTSW 14 104479764 nonsense probably null
R1774:Rnf219 UTSW 14 104479662 missense possibly damaging 0.68
R1922:Rnf219 UTSW 14 104479186 missense probably benign 0.02
R2018:Rnf219 UTSW 14 104522542 missense probably damaging 1.00
R2061:Rnf219 UTSW 14 104522532 splice site probably benign
R2182:Rnf219 UTSW 14 104506176 missense possibly damaging 0.55
R2336:Rnf219 UTSW 14 104478882 missense probably damaging 1.00
R4308:Rnf219 UTSW 14 104479593 missense probably damaging 0.97
R4355:Rnf219 UTSW 14 104479257 missense probably benign 0.01
R4703:Rnf219 UTSW 14 104506208 missense probably benign 0.03
R4738:Rnf219 UTSW 14 104510383 missense probably damaging 1.00
R4739:Rnf219 UTSW 14 104510383 missense probably damaging 1.00
R4869:Rnf219 UTSW 14 104478816 missense probably damaging 0.99
R5025:Rnf219 UTSW 14 104508030 missense probably damaging 1.00
R5054:Rnf219 UTSW 14 104508030 missense probably damaging 1.00
R5167:Rnf219 UTSW 14 104478787 missense probably damaging 1.00
R6356:Rnf219 UTSW 14 104478877 missense probably damaging 0.99
R6427:Rnf219 UTSW 14 104480226 missense possibly damaging 0.70
R6518:Rnf219 UTSW 14 104479065 missense probably damaging 1.00
R6619:Rnf219 UTSW 14 104522557 missense possibly damaging 0.88
R6731:Rnf219 UTSW 14 104479474 missense probably benign 0.06
R6754:Rnf219 UTSW 14 104503414 missense probably damaging 1.00
R6812:Rnf219 UTSW 14 104510432 missense unknown
R7225:Rnf219 UTSW 14 104479858 missense probably benign 0.00
R7567:Rnf219 UTSW 14 104479378 missense probably damaging 1.00
X0002:Rnf219 UTSW 14 104507977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAGGAAGCAAAGCAGTCTG -3'
(R):5'- ACTAGCTGACTCCGGTTCTG -3'

Sequencing Primer
(F):5'- TTGAGGAAGCAAAGCAGTCTGATTTC -3'
(R):5'- TTCTGTCAGACAGGAGAGCACC -3'
Posted On2018-05-21