Mutagenetix > Incidental Mutation

Incidental Mutation 'R6482:Col22a1'

517179

Institutional Source

Beutler Lab

Gene Symbol

Col22a1

Ensembl Gene

ENSMUSG00000079022

Gene Name

collagen, type XXII, alpha 1

Synonyms

C80743, 2310067L16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6482 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71795795-72034227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 71890489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 107 (P107L)

Ref Sequence

ENSEMBL: ENSMUSP00000124270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159993] [ENSMUST00000160513] [ENSMUST00000229585]

AlphaFold

E9Q7P1

Predicted Effect

unknown
Transcript: ENSMUST00000159993
AA Change: P996L

SMART Domains

Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: P996L

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
VWA	45	227	1.35e-51	SMART
TSPN	248	436	1.26e-33	SMART
low complexity region	454	470	N/A	INTRINSIC
internal_repeat_3	494	555	1.96e-13	PROSPERO
internal_repeat_1	496	643	1.49e-19	PROSPERO
low complexity region	644	657	N/A	INTRINSIC
low complexity region	673	707	N/A	INTRINSIC
Pfam:Collagen	751	823	1.5e-9	PFAM
Pfam:Collagen	810	863	2.3e-10	PFAM
Pfam:Collagen	869	931	4.8e-11	PFAM
Pfam:Collagen	926	990	1.1e-10	PFAM
Pfam:Collagen	1031	1087	1.7e-10	PFAM
Pfam:Collagen	1104	1162	1.8e-11	PFAM
low complexity region	1173	1227	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
internal_repeat_2	1257	1348	3.25e-18	PROSPERO
internal_repeat_4	1268	1347	9.67e-7	PROSPERO
Pfam:Collagen	1389	1448	4e-10	PFAM
Pfam:Collagen	1481	1540	2.6e-9	PFAM
low complexity region	1546	1558	N/A	INTRINSIC
low complexity region	1580	1590	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160513
AA Change: P107L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124270
Gene: ENSMUSG00000079022
AA Change: P107L

Domain	Start	End	E-Value	Type
Pfam:Collagen	1	60	5.7e-13	PFAM
Pfam:Collagen	43	102	1.3e-12	PFAM
Pfam:Collagen	100	143	2.2e-8	PFAM
Pfam:Collagen	142	194	1.9e-11	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000229585
AA Change: P441L

Meta Mutation Damage Score

0.0631

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	T	C	11: 70,011,562	I415V	probably benign	Het
Akap8l	A	G	17: 32,345,396	F6L	possibly damaging	Het
Ano3	T	A	2: 110,697,055	N603Y	probably damaging	Het
Casp8ap2	T	C	4: 32,634,813	S116P	probably damaging	Het
Ccdc110	A	T	8: 45,942,788	Q572L	probably benign	Het
Chit1	T	C	1: 134,143,242	S20P	probably damaging	Het
Dpys	T	C	15: 39,841,973	H248R	probably damaging	Het
Dsg2	A	T	18: 20,601,314	K783I	possibly damaging	Het
Efnb2	A	T	8: 8,620,637	V321E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Gm21936	A	G	12: 87,795,795	Y95C	probably damaging	Het
Gm35315	A	T	5: 110,078,089	C495S	possibly damaging	Het
Hrh1	A	G	6: 114,480,763	Q335R	possibly damaging	Het
Il12rb2	A	G	6: 67,356,686	L203P	probably damaging	Het
Itgav	T	C	2: 83,794,270	S735P	probably damaging	Het
Klrg1	G	T	6: 122,271,453	C162*	probably null	Het
Mcc	T	C	18: 44,445,864	S651G	possibly damaging	Het
Nkx2-2	T	A	2: 147,185,976	I15F	probably damaging	Het
Nppa	G	A	4: 148,000,871	V13I	probably benign	Het
Olfr1104	G	C	2: 87,022,525	F6L	probably benign	Het
Pde2a	A	G	7: 101,501,037	N228D	probably benign	Het
Pgpep1l	C	T	7: 68,239,067		probably null	Het
Plekhg3	A	G	12: 76,576,004	N673D	probably benign	Het
Plxna4	A	G	6: 32,516,737	S315P	probably benign	Het
Psg21	A	T	7: 18,654,739		probably null	Het
Rnf111	T	C	9: 70,429,607	T925A	probably damaging	Het
Rnf219	A	T	14: 104,479,817	C373*	probably null	Het
Spag9	T	C	11: 94,093,502	F734L	possibly damaging	Het
Tarbp1	A	G	8: 126,450,695	V746A	probably benign	Het
Tmtc1	A	G	6: 148,412,745	F119L	probably benign	Het
Ttc21b	A	G	2: 66,226,900	M576T	probably benign	Het
Usp48	T	A	4: 137,634,921	V765E	probably damaging	Het
Vmn1r20	A	G	6: 57,432,108	S140G	probably benign	Het
Vwde	A	G	6: 13,205,844	S235P	probably damaging	Het
Wapl	A	G	14: 34,692,692	S504G	probably benign	Het
Wnt5b	A	T	6: 119,433,612	L289Q	possibly damaging	Het
Zfp142	G	A	1: 74,570,217		probably null	Het
Zfp385b	ATCTTCTTCTTCT	ATCTTCTTCTTCTTCT	2: 77,719,648		probably benign	Het
Zfp948	A	G	17: 21,587,551	H335R	probably benign	Het

Other mutations in Col22a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Col22a1	APN	15	71860958	critical splice donor site	probably null
IGL00434:Col22a1	APN	15	72006675	missense	possibly damaging	0.71
IGL00721:Col22a1	APN	15	71846177	missense	unknown
IGL00902:Col22a1	APN	15	71964659	missense	probably damaging	1.00
IGL01311:Col22a1	APN	15	71973637	splice site	probably benign
IGL01329:Col22a1	APN	15	71907040	missense	probably benign	0.02
IGL01527:Col22a1	APN	15	71907031	missense	probably damaging	0.98
IGL01870:Col22a1	APN	15	71952528	missense	probably benign	0.07
IGL02002:Col22a1	APN	15	71811097	splice site	probably benign
IGL02248:Col22a1	APN	15	71799448	missense	unknown
IGL02322:Col22a1	APN	15	71822653	missense	unknown
IGL02472:Col22a1	APN	15	71827753	splice site	probably benign
IGL02685:Col22a1	APN	15	71801915	missense	unknown
IGL02888:Col22a1	APN	15	71846219	missense	unknown
IGL02971:Col22a1	APN	15	72006738	missense	probably damaging	1.00
IGL03175:Col22a1	APN	15	71969103	missense	possibly damaging	0.81
IGL03240:Col22a1	APN	15	71807928	missense	unknown
R0083:Col22a1	UTSW	15	71890497	missense	possibly damaging	0.70
R0383:Col22a1	UTSW	15	71869004	missense	unknown
R0449:Col22a1	UTSW	15	71962671	critical splice donor site	probably null
R0508:Col22a1	UTSW	15	71933413	missense	unknown
R0944:Col22a1	UTSW	15	71881662	missense	probably benign	0.03
R1289:Col22a1	UTSW	15	71837377	missense	unknown
R1436:Col22a1	UTSW	15	71922957	splice site	probably benign
R1439:Col22a1	UTSW	15	71952377	splice site	probably benign
R1460:Col22a1	UTSW	15	71821931	missense	unknown
R1680:Col22a1	UTSW	15	71799361	missense	unknown
R1715:Col22a1	UTSW	15	72006981	missense	possibly damaging	0.79
R1742:Col22a1	UTSW	15	71801913	missense	unknown
R1745:Col22a1	UTSW	15	72006787	missense	probably damaging	1.00
R1763:Col22a1	UTSW	15	72007176	missense	probably damaging	0.96
R1932:Col22a1	UTSW	15	71870140	missense	unknown
R2125:Col22a1	UTSW	15	71848577	missense	unknown
R2126:Col22a1	UTSW	15	71857253	nonsense	probably null
R2137:Col22a1	UTSW	15	72006948	missense	possibly damaging	0.46
R2860:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2861:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2862:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R3704:Col22a1	UTSW	15	71970307	missense	probably damaging	1.00
R3778:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R3940:Col22a1	UTSW	15	71981933	nonsense	probably null
R3950:Col22a1	UTSW	15	71977358	missense	possibly damaging	0.90
R4240:Col22a1	UTSW	15	72007131	missense	probably damaging	1.00
R4531:Col22a1	UTSW	15	72007149	missense	probably damaging	1.00
R4597:Col22a1	UTSW	15	71964662	missense	possibly damaging	0.83
R4604:Col22a1	UTSW	15	71952339	missense	probably benign	0.36
R4654:Col22a1	UTSW	15	71973695	missense	possibly damaging	0.95
R4782:Col22a1	UTSW	15	71801925	missense	unknown
R4847:Col22a1	UTSW	15	71799499	missense	unknown
R4980:Col22a1	UTSW	15	71801943	missense	unknown
R4981:Col22a1	UTSW	15	71861066	missense	unknown
R4996:Col22a1	UTSW	15	72007161	missense	probably damaging	0.99
R5007:Col22a1	UTSW	15	71944422	missense	probably damaging	1.00
R5135:Col22a1	UTSW	15	71799337	missense	unknown
R5197:Col22a1	UTSW	15	72009406	missense	probably damaging	0.96
R5292:Col22a1	UTSW	15	71970336	missense	probably damaging	1.00
R5449:Col22a1	UTSW	15	71821949	missense	unknown
R5480:Col22a1	UTSW	15	71964611	missense	probably damaging	0.98
R5627:Col22a1	UTSW	15	71981918	missense	probably damaging	0.98
R5828:Col22a1	UTSW	15	72009491	missense	probably benign	0.01
R5927:Col22a1	UTSW	15	72006966	missense	probably damaging	1.00
R6006:Col22a1	UTSW	15	71973836	missense	probably damaging	1.00
R6245:Col22a1	UTSW	15	71973816	missense	probably damaging	0.99
R6288:Col22a1	UTSW	15	71894869	critical splice acceptor site	probably null
R6497:Col22a1	UTSW	15	71890576	missense	possibly damaging	0.85
R6579:Col22a1	UTSW	15	71881653	missense	probably benign	0.18
R6643:Col22a1	UTSW	15	71822037	splice site	probably null
R6663:Col22a1	UTSW	15	71820059	missense	unknown
R7179:Col22a1	UTSW	15	71933413	missense	unknown
R7215:Col22a1	UTSW	15	71970332	nonsense	probably null
R7216:Col22a1	UTSW	15	71973845	missense	probably damaging	1.00
R7505:Col22a1	UTSW	15	71799399	nonsense	probably null
R7585:Col22a1	UTSW	15	71892205	missense	probably damaging	0.99
R7699:Col22a1	UTSW	15	71973851	missense	probably damaging	1.00
R7788:Col22a1	UTSW	15	71952317	critical splice donor site	probably null
R7921:Col22a1	UTSW	15	71981962	splice site	probably null
R8205:Col22a1	UTSW	15	71861069	missense	unknown
R8769:Col22a1	UTSW	15	72006722	missense	probably benign	0.21
R8780:Col22a1	UTSW	15	72006947	missense	probably damaging	0.99
R8827:Col22a1	UTSW	15	71902816	critical splice donor site	probably null
R8843:Col22a1	UTSW	15	72006654	missense	probably damaging	1.00
R8982:Col22a1	UTSW	15	71973638	critical splice donor site	probably null
R9031:Col22a1	UTSW	15	71881674	nonsense	probably null
R9036:Col22a1	UTSW	15	71890582	missense	probably damaging	1.00
R9084:Col22a1	UTSW	15	71820080	missense	unknown
R9281:Col22a1	UTSW	15	71861071	missense	unknown
R9386:Col22a1	UTSW	15	71981945	missense	probably damaging	1.00
R9406:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R9577:Col22a1	UTSW	15	71965746	missense	probably damaging	0.99
R9727:Col22a1	UTSW	15	71977274	missense	probably damaging	1.00
X0066:Col22a1	UTSW	15	71801879	missense	unknown
X0066:Col22a1	UTSW	15	71846200	missense	unknown
Y5406:Col22a1	UTSW	15	71799515	missense	unknown
Z1177:Col22a1	UTSW	15	71915120	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGGATTAAGTCACAGATTTCAGCAG -3'
(R):5'- GCTGATTAGCCGTTGGATAGC -3'

Sequencing Primer
(F):5'- GTCACAGATTTCAGCAGTAATTCATG -3'
(R):5'- CAGAGTTCTGCCTGCTGCTAATG -3'

Posted On

2018-05-21