Mutagenetix > Incidental Mutation

Incidental Mutation 'R6482:Akap8l'

517181

Institutional Source

Beutler Lab

Gene Symbol

Akap8l

Ensembl Gene

ENSMUSG00000002625

Gene Name

A kinase (PRKA) anchor protein 8-like

Synonyms

Nakap95

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.641) question?

Stock #

R6482 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32321425-32350581 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32345396 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 6 (F6L)

Ref Sequence

ENSEMBL: ENSMUSP00000051389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050214]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000050214
AA Change: F6L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000051389
Gene: ENSMUSG00000002625
AA Change: F6L

Domain	Start	End	E-Value	Type
low complexity region	37	62	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
low complexity region	112	120	N/A	INTRINSIC
low complexity region	236	257	N/A	INTRINSIC
low complexity region	296	306	N/A	INTRINSIC
low complexity region	307	324	N/A	INTRINSIC
low complexity region	330	350	N/A	INTRINSIC
coiled coil region	356	383	N/A	INTRINSIC
ZnF_C2H2	389	413	1.05e1	SMART
SCOP:d1jvr__	538	613	7e-5	SMART
low complexity region	628	640	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	T	C	11: 70,011,562	I415V	probably benign	Het
Ano3	T	A	2: 110,697,055	N603Y	probably damaging	Het
Casp8ap2	T	C	4: 32,634,813	S116P	probably damaging	Het
Ccdc110	A	T	8: 45,942,788	Q572L	probably benign	Het
Chit1	T	C	1: 134,143,242	S20P	probably damaging	Het
Col22a1	G	A	15: 71,890,489	P107L	possibly damaging	Het
Dpys	T	C	15: 39,841,973	H248R	probably damaging	Het
Dsg2	A	T	18: 20,601,314	K783I	possibly damaging	Het
Efnb2	A	T	8: 8,620,637	V321E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Gm21936	A	G	12: 87,795,795	Y95C	probably damaging	Het
Gm35315	A	T	5: 110,078,089	C495S	possibly damaging	Het
Hrh1	A	G	6: 114,480,763	Q335R	possibly damaging	Het
Il12rb2	A	G	6: 67,356,686	L203P	probably damaging	Het
Itgav	T	C	2: 83,794,270	S735P	probably damaging	Het
Klrg1	G	T	6: 122,271,453	C162*	probably null	Het
Mcc	T	C	18: 44,445,864	S651G	possibly damaging	Het
Nkx2-2	T	A	2: 147,185,976	I15F	probably damaging	Het
Nppa	G	A	4: 148,000,871	V13I	probably benign	Het
Olfr1104	G	C	2: 87,022,525	F6L	probably benign	Het
Pde2a	A	G	7: 101,501,037	N228D	probably benign	Het
Pgpep1l	C	T	7: 68,239,067		probably null	Het
Plekhg3	A	G	12: 76,576,004	N673D	probably benign	Het
Plxna4	A	G	6: 32,516,737	S315P	probably benign	Het
Psg21	A	T	7: 18,654,739		probably null	Het
Rnf111	T	C	9: 70,429,607	T925A	probably damaging	Het
Rnf219	A	T	14: 104,479,817	C373*	probably null	Het
Spag9	T	C	11: 94,093,502	F734L	possibly damaging	Het
Tarbp1	A	G	8: 126,450,695	V746A	probably benign	Het
Tmtc1	A	G	6: 148,412,745	F119L	probably benign	Het
Ttc21b	A	G	2: 66,226,900	M576T	probably benign	Het
Usp48	T	A	4: 137,634,921	V765E	probably damaging	Het
Vmn1r20	A	G	6: 57,432,108	S140G	probably benign	Het
Vwde	A	G	6: 13,205,844	S235P	probably damaging	Het
Wapl	A	G	14: 34,692,692	S504G	probably benign	Het
Wnt5b	A	T	6: 119,433,612	L289Q	possibly damaging	Het
Zfp142	G	A	1: 74,570,217		probably null	Het
Zfp385b	ATCTTCTTCTTCT	ATCTTCTTCTTCTTCT	2: 77,719,648		probably benign	Het
Zfp948	A	G	17: 21,587,551	H335R	probably benign	Het

Other mutations in Akap8l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Akap8l	APN	17	32333097	missense	possibly damaging	0.82
IGL01603:Akap8l	APN	17	32345353	missense	probably damaging	1.00
IGL02028:Akap8l	APN	17	32338521	splice site	probably null
IGL02033:Akap8l	APN	17	32338272	missense	probably damaging	1.00
IGL02301:Akap8l	APN	17	32332926	splice site	probably benign
R1136:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1137:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1192:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1277:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1279:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1703:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1705:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1706:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1727:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1763:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1774:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1796:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1954:Akap8l	UTSW	17	32336736	missense	possibly damaging	0.74
R2072:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R2073:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R2074:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R2107:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R2108:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R2214:Akap8l	UTSW	17	32338825	critical splice acceptor site	probably null
R2215:Akap8l	UTSW	17	32321595	missense	possibly damaging	0.72
R2219:Akap8l	UTSW	17	32334631	missense	probably benign	0.23
R2234:Akap8l	UTSW	17	32338803	missense	probably damaging	1.00
R2871:Akap8l	UTSW	17	32338442	missense	possibly damaging	0.84
R2871:Akap8l	UTSW	17	32338442	missense	possibly damaging	0.84
R4273:Akap8l	UTSW	17	32321931	nonsense	probably null
R4379:Akap8l	UTSW	17	32321514	unclassified	probably benign
R5061:Akap8l	UTSW	17	32332894	missense	probably damaging	1.00
R5337:Akap8l	UTSW	17	32336394	missense	possibly damaging	0.71
R5377:Akap8l	UTSW	17	32321511	unclassified	probably benign
R5579:Akap8l	UTSW	17	32321942	missense	probably damaging	1.00
R5609:Akap8l	UTSW	17	32338400	missense	probably damaging	1.00
R5667:Akap8l	UTSW	17	32338292	missense	probably damaging	1.00
R5671:Akap8l	UTSW	17	32338292	missense	probably damaging	1.00
R5747:Akap8l	UTSW	17	32345378	missense	probably damaging	0.97
R6186:Akap8l	UTSW	17	32333044	missense	probably benign	0.02
R6400:Akap8l	UTSW	17	32336320	missense	probably damaging	0.99
R6712:Akap8l	UTSW	17	32332888	missense	probably damaging	1.00
R7165:Akap8l	UTSW	17	32338412	missense	probably damaging	0.99
R7485:Akap8l	UTSW	17	32335571	missense	probably benign	0.03
R7729:Akap8l	UTSW	17	32333094	missense	probably damaging	1.00
R9437:Akap8l	UTSW	17	32334634	missense	probably benign	0.24
R9651:Akap8l	UTSW	17	32338809	missense	probably damaging	1.00
R9652:Akap8l	UTSW	17	32338809	missense	probably damaging	1.00
V5088:Akap8l	UTSW	17	32336739	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTACAGATTGCCTCAAAGAAGCAC -3'
(R):5'- ACAAGTTAAGCATGACCTGTCTG -3'

Sequencing Primer
(F):5'- CACAGTGCCACATATCAGGTTGG -3'
(R):5'- AAGCATGACCTGTCTGTACTG -3'

Posted On

2018-05-21