Mutagenetix > Incidental Mutation

Incidental Mutation 'R6482:Mcc'

517184

Institutional Source

Beutler Lab

Gene Symbol

Mcc

Ensembl Gene

ENSMUSG00000071856

Gene Name

mutated in colorectal cancers

Synonyms

D18Ertd451e

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6482 (G1)

Quality Score

215.009

Status

Validated

Chromosome

Chromosomal Location

44425060-44812182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44445864 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 651 (S651G)

Ref Sequence

ENSEMBL: ENSMUSP00000128032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089874] [ENSMUST00000164666]

AlphaFold

E9PWI3

Predicted Effect

probably benign
Transcript: ENSMUST00000089874
AA Change: S826G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856
AA Change: S826G

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
EFh	24	52	1.36e-3	SMART
EFh	57	85	7.36e0	SMART
coiled coil region	196	308	N/A	INTRINSIC
coiled coil region	395	466	N/A	INTRINSIC
low complexity region	488	493	N/A	INTRINSIC
low complexity region	512	517	N/A	INTRINSIC
low complexity region	523	537	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	577	641	2.6e-32	PFAM
low complexity region	715	731	N/A	INTRINSIC
coiled coil region	738	834	N/A	INTRINSIC
low complexity region	853	863	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	906	972	1.1e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164666
AA Change: S651G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128032
Gene: ENSMUSG00000071856
AA Change: S651G

Domain	Start	End	E-Value	Type
coiled coil region	21	133	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	233	289	1.2e-14	PFAM
low complexity region	313	318	N/A	INTRINSIC
low complexity region	337	342	N/A	INTRINSIC
low complexity region	348	362	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	401	467	3.8e-32	PFAM
low complexity region	540	556	N/A	INTRINSIC
coiled coil region	563	659	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	730	798	1.3e-27	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	T	C	11: 70,011,562	I415V	probably benign	Het
Akap8l	A	G	17: 32,345,396	F6L	possibly damaging	Het
Ano3	T	A	2: 110,697,055	N603Y	probably damaging	Het
Casp8ap2	T	C	4: 32,634,813	S116P	probably damaging	Het
Ccdc110	A	T	8: 45,942,788	Q572L	probably benign	Het
Chit1	T	C	1: 134,143,242	S20P	probably damaging	Het
Col22a1	G	A	15: 71,890,489	P107L	possibly damaging	Het
Dpys	T	C	15: 39,841,973	H248R	probably damaging	Het
Dsg2	A	T	18: 20,601,314	K783I	possibly damaging	Het
Efnb2	A	T	8: 8,620,637	V321E	probably damaging	Het
Fbxo11	A	T	17: 88,012,658	Y209N	probably benign	Het
Gm21936	A	G	12: 87,795,795	Y95C	probably damaging	Het
Gm35315	A	T	5: 110,078,089	C495S	possibly damaging	Het
Hrh1	A	G	6: 114,480,763	Q335R	possibly damaging	Het
Il12rb2	A	G	6: 67,356,686	L203P	probably damaging	Het
Itgav	T	C	2: 83,794,270	S735P	probably damaging	Het
Klrg1	G	T	6: 122,271,453	C162*	probably null	Het
Nkx2-2	T	A	2: 147,185,976	I15F	probably damaging	Het
Nppa	G	A	4: 148,000,871	V13I	probably benign	Het
Olfr1104	G	C	2: 87,022,525	F6L	probably benign	Het
Pde2a	A	G	7: 101,501,037	N228D	probably benign	Het
Pgpep1l	C	T	7: 68,239,067		probably null	Het
Plekhg3	A	G	12: 76,576,004	N673D	probably benign	Het
Plxna4	A	G	6: 32,516,737	S315P	probably benign	Het
Psg21	A	T	7: 18,654,739		probably null	Het
Rnf111	T	C	9: 70,429,607	T925A	probably damaging	Het
Rnf219	A	T	14: 104,479,817	C373*	probably null	Het
Spag9	T	C	11: 94,093,502	F734L	possibly damaging	Het
Tarbp1	A	G	8: 126,450,695	V746A	probably benign	Het
Tmtc1	A	G	6: 148,412,745	F119L	probably benign	Het
Ttc21b	A	G	2: 66,226,900	M576T	probably benign	Het
Usp48	T	A	4: 137,634,921	V765E	probably damaging	Het
Vmn1r20	A	G	6: 57,432,108	S140G	probably benign	Het
Vwde	A	G	6: 13,205,844	S235P	probably damaging	Het
Wapl	A	G	14: 34,692,692	S504G	probably benign	Het
Wnt5b	A	T	6: 119,433,612	L289Q	possibly damaging	Het
Zfp142	G	A	1: 74,570,217		probably null	Het
Zfp385b	ATCTTCTTCTTCT	ATCTTCTTCTTCTTCT	2: 77,719,648		probably benign	Het
Zfp948	A	G	17: 21,587,551	H335R	probably benign	Het

Other mutations in Mcc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Mcc	APN	18	44449216	missense	possibly damaging	0.93
IGL00981:Mcc	APN	18	44449349	missense	probably damaging	0.99
IGL00985:Mcc	APN	18	44491239	missense	probably damaging	1.00
IGL01674:Mcc	APN	18	44491156	missense	probably benign	0.10
IGL01862:Mcc	APN	18	44759296	missense	probably benign	0.00
IGL01935:Mcc	APN	18	44519516	critical splice donor site	probably null
IGL02168:Mcc	APN	18	44449299	missense	probably damaging	0.97
IGL02449:Mcc	APN	18	44459958	missense	probably benign	0.10
IGL02613:Mcc	APN	18	44429954	missense	probably damaging	1.00
IGL02709:Mcc	APN	18	44445810	missense	possibly damaging	0.73
R0009:Mcc	UTSW	18	44445933	missense	probably damaging	1.00
R0009:Mcc	UTSW	18	44445933	missense	probably damaging	1.00
R0021:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0022:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0062:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0062:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0063:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0064:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0217:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0218:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0243:Mcc	UTSW	18	44759299	missense	probably benign
R0373:Mcc	UTSW	18	44475222	missense	probably benign	0.01
R0564:Mcc	UTSW	18	44468507	missense	probably damaging	1.00
R0604:Mcc	UTSW	18	44473756	missense	probably damaging	1.00
R0691:Mcc	UTSW	18	44445860	missense	possibly damaging	0.67
R0965:Mcc	UTSW	18	44724526	missense	probably benign	0.41
R1015:Mcc	UTSW	18	44724669	missense	probably benign
R1186:Mcc	UTSW	18	44759403	missense	probably benign
R1215:Mcc	UTSW	18	44468494	missense	possibly damaging	0.93
R1878:Mcc	UTSW	18	44468400	missense	possibly damaging	0.69
R1990:Mcc	UTSW	18	44491315	nonsense	probably null
R1991:Mcc	UTSW	18	44491315	nonsense	probably null
R1992:Mcc	UTSW	18	44491315	nonsense	probably null
R2186:Mcc	UTSW	18	44812078	missense	possibly damaging	0.71
R2189:Mcc	UTSW	18	44534230	missense	possibly damaging	0.93
R2258:Mcc	UTSW	18	44475136	missense	probably damaging	1.00
R2267:Mcc	UTSW	18	44519541	missense	probably damaging	0.99
R2310:Mcc	UTSW	18	44431366	missense	probably damaging	1.00
R2343:Mcc	UTSW	18	44459797	critical splice donor site	probably null
R2377:Mcc	UTSW	18	44519549	missense	probably damaging	1.00
R3110:Mcc	UTSW	18	44449263	missense	probably damaging	1.00
R3112:Mcc	UTSW	18	44449263	missense	probably damaging	1.00
R4135:Mcc	UTSW	18	44724640	missense	probably benign	0.03
R4404:Mcc	UTSW	18	44759298	missense	probably benign
R4600:Mcc	UTSW	18	44519520	missense	probably damaging	1.00
R4606:Mcc	UTSW	18	44468421	missense	probably damaging	0.96
R4721:Mcc	UTSW	18	44519556	missense	probably damaging	1.00
R5858:Mcc	UTSW	18	44510141	missense	probably damaging	0.98
R5997:Mcc	UTSW	18	44449321	missense	probably damaging	1.00
R6502:Mcc	UTSW	18	44468390	nonsense	probably null
R6502:Mcc	UTSW	18	44468391	missense	probably damaging	1.00
R6518:Mcc	UTSW	18	44661811	start gained	probably benign
R6796:Mcc	UTSW	18	44724560	missense	probably benign
R6846:Mcc	UTSW	18	44473640	missense	possibly damaging	0.63
R6879:Mcc	UTSW	18	44812112	missense	unknown
R7147:Mcc	UTSW	18	44493513	missense	probably damaging	0.99
R7475:Mcc	UTSW	18	44476236	missense	probably damaging	0.98
R7515:Mcc	UTSW	18	44493432	missense	probably benign	0.02
R7608:Mcc	UTSW	18	44491227	missense	possibly damaging	0.83
R8092:Mcc	UTSW	18	44759232	missense	probably benign	0.00
R8119:Mcc	UTSW	18	44468433	missense	possibly damaging	0.95
R8162:Mcc	UTSW	18	44449441	critical splice acceptor site	probably null
R8187:Mcc	UTSW	18	44534260	missense	possibly damaging	0.53
R8716:Mcc	UTSW	18	44449336	missense	possibly damaging	0.92
R8744:Mcc	UTSW	18	44724572	missense	probably benign
R9383:Mcc	UTSW	18	44442918	missense	probably benign	0.24
R9517:Mcc	UTSW	18	44661727	missense	probably damaging	1.00
R9570:Mcc	UTSW	18	44445858	missense	probably damaging	0.97
R9590:Mcc	UTSW	18	44459910	missense	possibly damaging	0.93
X0010:Mcc	UTSW	18	44429957	missense	possibly damaging	0.94
Z1177:Mcc	UTSW	18	44491246	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACGCCTATGTAACCAGCAAG -3'
(R):5'- CCATGGCTTATAGACAGGTCG -3'

Sequencing Primer
(F):5'- GGTAATGCCTGCACTGAGG -3'
(R):5'- GACAGGTCGTCTTCTGCAC -3'

Posted On

2018-05-21