Incidental Mutation 'R6483:Atp2b4'
ID517186
Institutional Source Beutler Lab
Gene Symbol Atp2b4
Ensembl Gene ENSMUSG00000026463
Gene NameATPase, Ca++ transporting, plasma membrane 4
SynonymsPMCA4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133699457-133801041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133729880 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 624 (V624A)
Ref Sequence ENSEMBL: ENSMUSP00000116941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048953] [ENSMUST00000112264] [ENSMUST00000125659] [ENSMUST00000143567] [ENSMUST00000165602]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048953
AA Change: V624A

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047978
Gene: ENSMUSG00000026463
AA Change: V624A

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.7e-58 PFAM
Pfam:Hydrolase 460 798 3e-26 PFAM
Pfam:HAD 463 795 7.4e-15 PFAM
Pfam:Hydrolase_like2 510 605 3.6e-17 PFAM
Pfam:Hydrolase_3 756 831 2.7e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1153 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112264
AA Change: V624A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107883
Gene: ENSMUSG00000026463
AA Change: V624A

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.3e-58 PFAM
Pfam:Hydrolase 460 798 1.2e-26 PFAM
Pfam:HAD 463 795 3.5e-15 PFAM
Pfam:Hydrolase_like2 510 605 4.6e-17 PFAM
Pfam:Hydrolase_3 756 831 9.1e-7 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1104 7.4e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125659
AA Change: V624A

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116941
Gene: ENSMUSG00000026463
AA Change: V624A

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.7e-58 PFAM
Pfam:Hydrolase 460 798 3e-26 PFAM
Pfam:HAD 463 795 7.4e-15 PFAM
Pfam:Hydrolase_like2 510 605 3.6e-17 PFAM
Pfam:Hydrolase_3 756 831 2.7e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1153 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143567
AA Change: V624A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000119242
Gene: ENSMUSG00000026463
AA Change: V624A

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 153 301 6.8e-29 PFAM
Pfam:E1-E2_ATPase 338 455 1.9e-13 PFAM
Pfam:HAD 463 795 1e-21 PFAM
Pfam:Cation_ATPase 509 605 5.8e-17 PFAM
Pfam:Hydrolase 577 798 5e-15 PFAM
Pfam:Hydrolase_3 756 831 6.6e-7 PFAM
Pfam:Cation_ATPase_C 868 1050 4.5e-45 PFAM
Pfam:ATP_Ca_trans_C 1090 1141 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165602
AA Change: V624A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133187
Gene: ENSMUSG00000026463
AA Change: V624A

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.5e-58 PFAM
Pfam:Hydrolase 460 798 1.4e-26 PFAM
Pfam:HAD 463 795 4.1e-15 PFAM
Pfam:Hydrolase_like2 510 605 5.1e-17 PFAM
Pfam:Hydrolase_3 756 831 1e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.3e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1151 4.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183597
Meta Mutation Damage Score 0.1506 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 4. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility with impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Atp2b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Atp2b4 APN 1 133731889 missense probably damaging 1.00
IGL02887:Atp2b4 APN 1 133728774 missense probably damaging 1.00
IGL02964:Atp2b4 APN 1 133730565 missense probably damaging 1.00
IGL03116:Atp2b4 APN 1 133728768 missense possibly damaging 0.95
IGL03227:Atp2b4 APN 1 133729707 splice site probably benign
R0018:Atp2b4 UTSW 1 133717871 missense probably damaging 1.00
R0018:Atp2b4 UTSW 1 133717871 missense probably damaging 1.00
R0279:Atp2b4 UTSW 1 133729702 splice site probably benign
R0455:Atp2b4 UTSW 1 133728716 missense probably damaging 1.00
R0511:Atp2b4 UTSW 1 133732218 splice site probably benign
R0712:Atp2b4 UTSW 1 133730478 missense probably damaging 1.00
R1469:Atp2b4 UTSW 1 133706939 missense probably damaging 0.97
R1469:Atp2b4 UTSW 1 133706939 missense probably damaging 0.97
R1529:Atp2b4 UTSW 1 133717988 missense probably damaging 1.00
R1771:Atp2b4 UTSW 1 133732393 missense probably damaging 0.96
R1954:Atp2b4 UTSW 1 133739992 missense probably damaging 1.00
R2054:Atp2b4 UTSW 1 133715169 missense probably benign 0.03
R2056:Atp2b4 UTSW 1 133726537 missense probably benign 0.36
R2059:Atp2b4 UTSW 1 133726537 missense probably benign 0.36
R2091:Atp2b4 UTSW 1 133715230 missense probably benign 0.00
R2263:Atp2b4 UTSW 1 133726533 missense probably benign 0.35
R3907:Atp2b4 UTSW 1 133738586 missense probably damaging 1.00
R4362:Atp2b4 UTSW 1 133739931 missense possibly damaging 0.94
R4756:Atp2b4 UTSW 1 133711791 missense probably benign 0.00
R4756:Atp2b4 UTSW 1 133739396 missense probably benign 0.41
R4856:Atp2b4 UTSW 1 133706780 missense probably benign 0.00
R4886:Atp2b4 UTSW 1 133706780 missense probably benign 0.00
R5177:Atp2b4 UTSW 1 133728768 missense probably benign 0.00
R5454:Atp2b4 UTSW 1 133729872 missense probably damaging 1.00
R5594:Atp2b4 UTSW 1 133730510 missense probably damaging 1.00
R5712:Atp2b4 UTSW 1 133730540 missense probably damaging 1.00
R6034:Atp2b4 UTSW 1 133731907 critical splice acceptor site probably null
R6034:Atp2b4 UTSW 1 133731907 critical splice acceptor site probably null
R6078:Atp2b4 UTSW 1 133701702 small insertion probably benign
R6079:Atp2b4 UTSW 1 133701702 small insertion probably benign
R6244:Atp2b4 UTSW 1 133726561 missense probably damaging 1.00
R6376:Atp2b4 UTSW 1 133715059 missense probably damaging 1.00
R6526:Atp2b4 UTSW 1 133711729 missense probably damaging 0.99
R6725:Atp2b4 UTSW 1 133706987 missense probably benign 0.01
R6801:Atp2b4 UTSW 1 133727786 missense probably damaging 0.97
R7548:Atp2b4 UTSW 1 133701641 makesense probably null
R8228:Atp2b4 UTSW 1 133701721 small insertion probably benign
R8248:Atp2b4 UTSW 1 133701718 small insertion probably benign
R8248:Atp2b4 UTSW 1 133701743 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGACAAGCGCTCCTGCTTTC -3'
(R):5'- CCCAAGAATGTCTGAGGGAC -3'

Sequencing Primer
(F):5'- AAAACGGGCAGGCCTTAC -3'
(R):5'- CAAGGTGGTGACCCATTTTGACC -3'
Posted On2018-05-21