Incidental Mutation 'R6483:Rnasel'
ID517187
Institutional Source Beutler Lab
Gene Symbol Rnasel
Ensembl Gene ENSMUSG00000066800
Gene Nameribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
Synonyms2-5A-dependent RNAase, E230029I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location153749426-153764221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153754686 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 316 (V316A)
Ref Sequence ENSEMBL: ENSMUSP00000138752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086209] [ENSMUST00000182538] [ENSMUST00000182722] [ENSMUST00000183241]
Predicted Effect probably benign
Transcript: ENSMUST00000086209
AA Change: V316A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083385
Gene: ENSMUSG00000066800
AA Change: V316A

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase 365 521 4.9e-19 PFAM
Pfam:Pkinase_Tyr 365 523 6.1e-14 PFAM
Pfam:Kdo 451 546 8e-8 PFAM
PUG 656 707 2.33e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182131
Predicted Effect probably benign
Transcript: ENSMUST00000182538
SMART Domains Protein: ENSMUSP00000138734
Gene: ENSMUSG00000066800

DomainStartEndE-ValueType
PUG 148 199 2.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182722
AA Change: V316A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138247
Gene: ENSMUSG00000066800
AA Change: V316A

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase_Tyr 364 523 2.4e-13 PFAM
Pfam:Pkinase 365 520 2.1e-18 PFAM
Pfam:Kdo 452 546 9.3e-7 PFAM
Pfam:Ribonuc_2-5A 589 651 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183241
AA Change: V316A

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138752
Gene: ENSMUSG00000066800
AA Change: V316A

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase_Tyr 364 523 2.6e-13 PFAM
Pfam:Pkinase 365 517 2.4e-18 PFAM
Pfam:Kdo 452 546 9.7e-7 PFAM
Pfam:Ribonuc_2-5A 589 674 1.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187415
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the interferon-regulated 2-5A system that functions in the antiviral and antiproliferative roles of interferons. Mutations in this gene have been associated with predisposition to prostate cancer and this gene is a candidate for the hereditary prostate cancer 1 (HPC1) allele. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an enlarged spleen and increased succeptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Rnasel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Rnasel APN 1 153758384 missense probably benign 0.04
IGL02662:Rnasel APN 1 153754111 missense probably damaging 1.00
IGL03215:Rnasel APN 1 153758555 missense probably damaging 1.00
R0022:Rnasel UTSW 1 153760775 missense probably damaging 1.00
R0022:Rnasel UTSW 1 153760775 missense probably damaging 1.00
R0028:Rnasel UTSW 1 153754719 missense probably benign 0.04
R0116:Rnasel UTSW 1 153754512 missense probably damaging 1.00
R0981:Rnasel UTSW 1 153759599 missense probably benign 0.03
R1523:Rnasel UTSW 1 153756013 missense probably damaging 0.98
R1538:Rnasel UTSW 1 153760794 missense possibly damaging 0.62
R1646:Rnasel UTSW 1 153755054 missense probably damaging 1.00
R1793:Rnasel UTSW 1 153754423 missense probably damaging 0.98
R1843:Rnasel UTSW 1 153754674 missense possibly damaging 0.94
R2158:Rnasel UTSW 1 153754901 missense probably damaging 1.00
R2434:Rnasel UTSW 1 153754650 missense probably damaging 1.00
R2895:Rnasel UTSW 1 153760776 missense probably damaging 1.00
R4107:Rnasel UTSW 1 153754796 missense probably benign 0.00
R5013:Rnasel UTSW 1 153753931 missense probably damaging 0.99
R5015:Rnasel UTSW 1 153754097 nonsense probably null
R5540:Rnasel UTSW 1 153755144 nonsense probably null
R5688:Rnasel UTSW 1 153753706 start gained probably benign
R5955:Rnasel UTSW 1 153754400 missense probably benign 0.05
R6131:Rnasel UTSW 1 153754460 missense probably damaging 1.00
R6164:Rnasel UTSW 1 153754392 missense probably benign 0.32
R6395:Rnasel UTSW 1 153762121 missense probably damaging 0.99
R7470:Rnasel UTSW 1 153754031 missense probably benign 0.00
R7538:Rnasel UTSW 1 153754560 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACACAGGCTTGGTGCAGATG -3'
(R):5'- AGCCACTTCTCGATTGTCATAGATC -3'

Sequencing Primer
(F):5'- TGCAGATGCTCCTGAGTCG -3'
(R):5'- TGTCATAGATCCCTAGGTAGACAGC -3'
Posted On2018-05-21