Incidental Mutation 'R6483:Kcnh7'
ID517188
Institutional Source Beutler Lab
Gene Symbol Kcnh7
Ensembl Gene ENSMUSG00000059742
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 7
SynonymsKv11.3, 9330137I11Rik, erg3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location62693414-63184287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62845774 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 298 (D298V)
Ref Sequence ENSEMBL: ENSMUSP00000108073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075052] [ENSMUST00000112452] [ENSMUST00000112454]
Predicted Effect probably benign
Transcript: ENSMUST00000075052
AA Change: D298V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742
AA Change: D298V

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Pfam:Ion_trans 407 674 4.9e-39 PFAM
Pfam:Ion_trans_2 588 668 3.2e-13 PFAM
cNMP 745 863 1.5e-23 SMART
low complexity region 921 940 N/A INTRINSIC
coiled coil region 1022 1058 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112452
SMART Domains Protein: ENSMUSP00000108071
Gene: ENSMUSG00000059742

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Blast:MYSc 309 426 4e-24 BLAST
low complexity region 446 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112454
AA Change: D298V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108073
Gene: ENSMUSG00000059742
AA Change: D298V

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Blast:MYSc 316 433 3e-24 BLAST
low complexity region 453 468 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Kcnh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kcnh7 APN 2 62764691 missense probably benign 0.01
IGL00693:Kcnh7 APN 2 62734254 missense probably benign 0.06
IGL00776:Kcnh7 APN 2 62850376 missense probably benign 0.00
IGL00956:Kcnh7 APN 2 62777639 missense probably damaging 1.00
IGL01651:Kcnh7 APN 2 62734284 missense possibly damaging 0.47
IGL01780:Kcnh7 APN 2 62837163 missense probably benign 0.17
IGL01859:Kcnh7 APN 2 62721788 missense probably benign 0.00
IGL02213:Kcnh7 APN 2 62739362 missense probably damaging 1.00
IGL02302:Kcnh7 APN 2 62706058 missense probably damaging 1.00
IGL02526:Kcnh7 APN 2 62850437 missense possibly damaging 0.46
IGL02850:Kcnh7 APN 2 62787685 nonsense probably null
IGL02989:Kcnh7 APN 2 62721925 missense probably benign
IGL02990:Kcnh7 APN 2 62705986 missense probably benign 0.11
LCD18:Kcnh7 UTSW 2 63049799 intron probably benign
R0129:Kcnh7 UTSW 2 62716159 missense probably benign 0.00
R0622:Kcnh7 UTSW 2 62837289 splice site probably null
R0638:Kcnh7 UTSW 2 62777510 missense probably benign 0.13
R1006:Kcnh7 UTSW 2 62716183 missense probably benign 0.00
R1200:Kcnh7 UTSW 2 62777395 missense probably damaging 1.00
R1330:Kcnh7 UTSW 2 62777411 missense possibly damaging 0.56
R1614:Kcnh7 UTSW 2 62850604 missense probably benign 0.03
R1782:Kcnh7 UTSW 2 62736169 missense probably damaging 1.00
R1861:Kcnh7 UTSW 2 62777392 missense probably damaging 0.97
R1862:Kcnh7 UTSW 2 62787754 missense possibly damaging 0.46
R2197:Kcnh7 UTSW 2 62777606 missense probably damaging 1.00
R2510:Kcnh7 UTSW 2 62721917 missense probably benign
R2988:Kcnh7 UTSW 2 62721828 missense probably benign 0.20
R3024:Kcnh7 UTSW 2 62764663 missense probably damaging 1.00
R3433:Kcnh7 UTSW 2 62721917 missense probably benign
R4415:Kcnh7 UTSW 2 62706073 missense probably damaging 1.00
R4540:Kcnh7 UTSW 2 62739186 missense probably damaging 1.00
R4570:Kcnh7 UTSW 2 62837095 missense possibly damaging 0.91
R4827:Kcnh7 UTSW 2 62716220 missense probably benign
R4990:Kcnh7 UTSW 2 62734288 missense probably benign 0.00
R5172:Kcnh7 UTSW 2 62739164 missense possibly damaging 0.88
R5822:Kcnh7 UTSW 2 62716238 missense probably benign
R5996:Kcnh7 UTSW 2 63184097 start gained probably benign
R6142:Kcnh7 UTSW 2 62739360 missense possibly damaging 0.95
R6226:Kcnh7 UTSW 2 62777559 missense probably damaging 1.00
R6244:Kcnh7 UTSW 2 63182226 missense probably damaging 1.00
R6304:Kcnh7 UTSW 2 62764616 nonsense probably null
R6400:Kcnh7 UTSW 2 62739344 missense probably damaging 1.00
R6430:Kcnh7 UTSW 2 62850532 missense probably benign 0.04
R6614:Kcnh7 UTSW 2 62777596 missense probably damaging 1.00
R6753:Kcnh7 UTSW 2 62850377 missense probably benign
R6822:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
R6863:Kcnh7 UTSW 2 62787685 missense possibly damaging 0.83
R7104:Kcnh7 UTSW 2 62787687 missense possibly damaging 0.82
R7116:Kcnh7 UTSW 2 62877270 missense probably benign 0.02
R7263:Kcnh7 UTSW 2 62735970 splice site probably null
R7657:Kcnh7 UTSW 2 62736035 missense probably damaging 1.00
R7855:Kcnh7 UTSW 2 62837194 nonsense probably null
R7938:Kcnh7 UTSW 2 62837194 nonsense probably null
R8183:Kcnh7 UTSW 2 62702977 missense probably damaging 0.99
X0011:Kcnh7 UTSW 2 62764723 missense probably damaging 0.99
Z1088:Kcnh7 UTSW 2 62736103 missense probably damaging 1.00
Z1088:Kcnh7 UTSW 2 63184068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAAAGTAATCATGTCTCCAGC -3'
(R):5'- AAGTGACGTGAGGATTTCGC -3'

Sequencing Primer
(F):5'- GTAATCATGTCTCCAGCAAAATCAAG -3'
(R):5'- CGTGAGGATTTCGCTTAGTTATAATG -3'
Posted On2018-05-21