Incidental Mutation 'R6483:Olfr1037'
List |< first << previous [record 34 of 48] next >> last >|
ID517190
Institutional Source Beutler Lab
Gene Symbol Olfr1037
Ensembl Gene ENSMUSG00000075205
Gene Nameolfactory receptor 1037
SynonymsMOR171-52, MOR256-34P, GA_x6K02T2Q125-47560740-47559775
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86084671-86087385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86085440 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 112 (M112I)
Ref Sequence ENSEMBL: ENSMUSP00000150319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099911] [ENSMUST00000213333] [ENSMUST00000216020] [ENSMUST00000216886]
Predicted Effect probably benign
Transcript: ENSMUST00000099911
AA Change: M112I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097495
Gene: ENSMUSG00000075205
AA Change: M112I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-54 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117964
Predicted Effect probably benign
Transcript: ENSMUST00000213333
AA Change: M112I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216020
AA Change: M112I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216886
AA Change: M112I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Olfr1037
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Olfr1037 APN 2 86085640 missense probably benign 0.05
IGL02534:Olfr1037 APN 2 86085369 missense probably damaging 1.00
IGL03204:Olfr1037 APN 2 86085671 nonsense probably null
R0054:Olfr1037 UTSW 2 86085361 missense probably benign 0.38
R0054:Olfr1037 UTSW 2 86085361 missense probably benign 0.38
R0131:Olfr1037 UTSW 2 86085500 missense probably damaging 1.00
R0131:Olfr1037 UTSW 2 86085500 missense probably damaging 1.00
R0666:Olfr1037 UTSW 2 86085213 missense probably benign 0.03
R0732:Olfr1037 UTSW 2 86085584 missense probably benign 0.00
R1167:Olfr1037 UTSW 2 86085291 missense probably benign 0.16
R1899:Olfr1037 UTSW 2 86085720 missense probably benign
R3082:Olfr1037 UTSW 2 86085709 missense probably benign
R3847:Olfr1037 UTSW 2 86085407 nonsense probably null
R3848:Olfr1037 UTSW 2 86085407 nonsense probably null
R4079:Olfr1037 UTSW 2 86085312 missense possibly damaging 0.67
R4193:Olfr1037 UTSW 2 86085700 missense probably benign 0.01
R4832:Olfr1037 UTSW 2 86084846 missense probably benign 0.00
R5244:Olfr1037 UTSW 2 86084956 missense probably damaging 1.00
R5643:Olfr1037 UTSW 2 86085159 missense probably damaging 0.98
R5644:Olfr1037 UTSW 2 86085159 missense probably damaging 0.98
R5974:Olfr1037 UTSW 2 86084881 missense probably benign
R6136:Olfr1037 UTSW 2 86084901 missense probably damaging 1.00
R6189:Olfr1037 UTSW 2 86084913 missense possibly damaging 0.53
R6569:Olfr1037 UTSW 2 86085505 missense possibly damaging 0.87
R6724:Olfr1037 UTSW 2 86085357 missense possibly damaging 0.81
R6867:Olfr1037 UTSW 2 86085738 missense possibly damaging 0.59
R7081:Olfr1037 UTSW 2 86085595 missense probably damaging 1.00
R7207:Olfr1037 UTSW 2 86084815 missense possibly damaging 0.93
R7436:Olfr1037 UTSW 2 86084907 missense probably damaging 1.00
R8699:Olfr1037 UTSW 2 86085174 missense probably damaging 0.98
X0062:Olfr1037 UTSW 2 86085114 missense probably damaging 1.00
Z1088:Olfr1037 UTSW 2 86084982 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCCATCAAAGGGACATCATC -3'
(R):5'- GATGGATTCTAGACTTCACACTCC -3'

Sequencing Primer
(F):5'- TATTGGGGCCACAGTAAATCAGTTTG -3'
(R):5'- CTAGACTTCACACTCCCATGTAC -3'
Posted On2018-05-21