Incidental Mutation 'R6483:Gba'
ID517193
Institutional Source Beutler Lab
Gene Symbol Gba
Ensembl Gene ENSMUSG00000028048
Gene Nameglucosidase, beta, acid
Synonymsglucocerebrosidase, GCase, GC, betaGC, GBA1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89202928-89208966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89208603 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 510 (Y510C)
Ref Sequence ENSEMBL: ENSMUSP00000130660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073572] [ENSMUST00000077367] [ENSMUST00000118964] [ENSMUST00000152789] [ENSMUST00000167998] [ENSMUST00000174126] [ENSMUST00000197738]
Predicted Effect probably benign
Transcript: ENSMUST00000073572
SMART Domains Protein: ENSMUSP00000073261
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 4.2e-21 PFAM
Pfam:Tom37_C 239 317 8.1e-24 PFAM
Pfam:GST_C_3 267 383 1.7e-11 PFAM
Pfam:GST_C_2 270 377 2.7e-8 PFAM
Pfam:Tom37_C 300 369 1.1e-14 PFAM
low complexity region 396 415 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077367
AA Change: Y510C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076589
Gene: ENSMUSG00000028048
AA Change: Y510C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 512 1.4e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118964
SMART Domains Protein: ENSMUSP00000114009
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 5.9e-21 PFAM
Pfam:Tom37_C 216 287 6.3e-19 PFAM
Pfam:GST_C_3 216 352 5.1e-11 PFAM
Pfam:GST_C_2 238 344 1.9e-8 PFAM
Pfam:Tom37_C 269 338 9.5e-15 PFAM
low complexity region 365 384 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119222
SMART Domains Protein: ENSMUSP00000113986
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 12 57 1.6e-11 PFAM
Pfam:Tom37_C 138 216 5.4e-24 PFAM
Pfam:GST_C_3 166 282 1.1e-11 PFAM
Pfam:GST_C_2 169 276 1.8e-8 PFAM
Pfam:Tom37_C 199 268 7.2e-15 PFAM
low complexity region 295 314 N/A INTRINSIC
transmembrane domain 315 337 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124086
Predicted Effect probably benign
Transcript: ENSMUST00000129055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150303
Predicted Effect probably benign
Transcript: ENSMUST00000152789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156847
Predicted Effect probably damaging
Transcript: ENSMUST00000167998
AA Change: Y510C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130660
Gene: ENSMUSG00000028048
AA Change: Y510C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 512 1.4e-252 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173239
Predicted Effect probably benign
Transcript: ENSMUST00000173465
Predicted Effect probably benign
Transcript: ENSMUST00000173475
SMART Domains Protein: ENSMUSP00000134110
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
low complexity region 97 116 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173477
SMART Domains Protein: ENSMUSP00000133282
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 1 58 8.5e-16 PFAM
Pfam:Tom37_C 77 155 9.7e-24 PFAM
Pfam:GST_C_3 104 221 8.2e-12 PFAM
Pfam:GST_C_2 107 216 7.5e-9 PFAM
Pfam:Tom37_C 138 207 1.3e-14 PFAM
low complexity region 234 253 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173593
SMART Domains Protein: ENSMUSP00000133866
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 14 82 1.1e-21 PFAM
Pfam:Tom37_C 102 178 3.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196887
Predicted Effect probably benign
Transcript: ENSMUST00000197738
SMART Domains Protein: ENSMUSP00000142401
Gene: ENSMUSG00000028048

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 388 1e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200124
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mutations in this locus variably lower enzyme activity and result in accumulated glucocerebroside in reticuloendotehelial cell lysosomes and glucosylceramide in brain, liver and skin. Severe mutants die perinatally with compromised epidermal permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Gba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Gba APN 3 89205841 missense probably damaging 1.00
IGL02661:Gba APN 3 89203527 missense probably benign 0.02
IGL02832:Gba APN 3 89203502 missense probably benign
R0308:Gba UTSW 3 89208364 missense probably benign 0.00
R0811:Gba UTSW 3 89204000 missense probably benign 0.01
R0812:Gba UTSW 3 89204000 missense probably benign 0.01
R1517:Gba UTSW 3 89206148 missense probably damaging 1.00
R2119:Gba UTSW 3 89205561 missense probably benign 0.11
R4613:Gba UTSW 3 89208644 utr 3 prime probably null
R5371:Gba UTSW 3 89205471 missense probably benign 0.37
R5987:Gba UTSW 3 89205822 missense probably damaging 0.98
R6469:Gba UTSW 3 89204081 missense probably benign 0.12
R6470:Gba UTSW 3 89204081 missense probably benign 0.12
R6473:Gba UTSW 3 89204081 missense probably benign 0.12
R6474:Gba UTSW 3 89204081 missense probably benign 0.12
R6475:Gba UTSW 3 89205928 missense probably benign 0.00
R7190:Gba UTSW 3 89204362 missense probably damaging 1.00
Z1176:Gba UTSW 3 89204005 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGACTTGGAAACAGTAGCAC -3'
(R):5'- AATGAGACATCCGAACCCTTGG -3'

Sequencing Primer
(F):5'- AGTAGCACTGTTACGCCCTGAC -3'
(R):5'- ATCCGAACCCTTGGCCCTG -3'
Posted On2018-05-21