Incidental Mutation 'R6483:Bsnd'
ID517197
Institutional Source Beutler Lab
Gene Symbol Bsnd
Ensembl Gene ENSMUSG00000025418
Gene Namebarttin CLCNK type accessory beta subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6483 (G1)
Quality Score208.009
Status Validated
Chromosome4
Chromosomal Location106483456-106492283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106488015 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 78 (L78Q)
Ref Sequence ENSEMBL: ENSMUSP00000049563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054472]
Predicted Effect probably damaging
Transcript: ENSMUST00000054472
AA Change: L78Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049563
Gene: ENSMUSG00000025418
AA Change: L78Q

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Barttin 27 241 5.2e-110 PFAM
low complexity region 273 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential beta subunit for CLC chloride channels. These heteromeric channels localize to basolateral membranes of renal tubules and of potassium-secreting epithelia of the inner ear. Mutations in this gene have been associated with Bartter syndrome with sensorineural deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe dehydration and postnatal lethality. Mice homozygous for a cre-activated conditional allele exhibit hearing loss with outer hair cell and stria vascularis degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Bsnd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03220:Bsnd APN 4 106486765 missense possibly damaging 0.58
IGL02802:Bsnd UTSW 4 106492034 missense probably damaging 1.00
R1327:Bsnd UTSW 4 106486612 missense probably benign 0.08
R1869:Bsnd UTSW 4 106486636 missense probably benign 0.03
R1912:Bsnd UTSW 4 106488030 nonsense probably null
R4294:Bsnd UTSW 4 106485158 missense probably benign 0.01
R4411:Bsnd UTSW 4 106486671 missense probably benign
R5241:Bsnd UTSW 4 106487985 missense probably benign 0.21
R5733:Bsnd UTSW 4 106488001 missense probably benign 0.08
R6274:Bsnd UTSW 4 106486635 missense probably damaging 0.96
R7153:Bsnd UTSW 4 106492033 missense probably benign 0.09
R7184:Bsnd UTSW 4 106491912 missense probably damaging 1.00
X0023:Bsnd UTSW 4 106485417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTCAGAAAATTCAAGGCAAGG -3'
(R):5'- TCAAGCAGAGACCCTTCCAG -3'

Sequencing Primer
(F):5'- TTCAAGGCAAGGAGGAAACTG -3'
(R):5'- AGGTCCCCCTTCCGCTG -3'
Posted On2018-05-21