Incidental Mutation 'R6483:Nasp'
ID517198
Institutional Source Beutler Lab
Gene Symbol Nasp
Ensembl Gene ENSMUSG00000028693
Gene Namenuclear autoantigenic sperm protein (histone-binding)
SynonymsD4Ertd767e, 5033430J04Rik, Epcs32, Nasp-T
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116601052-116627941 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116618948 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 47 (L47Q)
Ref Sequence ENSEMBL: ENSMUSP00000079946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030456] [ENSMUST00000030457] [ENSMUST00000081182]
Predicted Effect probably damaging
Transcript: ENSMUST00000030456
AA Change: L47Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030456
Gene: ENSMUSG00000028693
AA Change: L47Q

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
TPR 528 561 3.05e0 SMART
TPR 570 603 2.38e-2 SMART
low complexity region 620 640 N/A INTRINSIC
low complexity region 703 715 N/A INTRINSIC
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000030457
AA Change: L47Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030457
Gene: ENSMUSG00000028693
AA Change: L47Q

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
TPR 203 236 3.05e0 SMART
TPR 245 278 2.38e-2 SMART
low complexity region 295 315 N/A INTRINSIC
low complexity region 378 390 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081182
AA Change: L47Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079946
Gene: ENSMUSG00000028693
AA Change: L47Q

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 6.2e-2 SMART
low complexity region 84 99 N/A INTRINSIC
low complexity region 106 126 N/A INTRINSIC
low complexity region 140 151 N/A INTRINSIC
TPR 176 209 1.4e-2 SMART
TPR 218 251 1.1e-4 SMART
low complexity region 268 288 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 390 407 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154811
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Nasp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nasp APN 4 116604219 missense probably damaging 1.00
IGL00780:Nasp APN 4 116603999 nonsense probably null
IGL00833:Nasp APN 4 116602736 missense probably damaging 1.00
IGL02232:Nasp APN 4 116604800 missense probably damaging 0.99
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0179:Nasp UTSW 4 116602157 missense probably damaging 1.00
R0385:Nasp UTSW 4 116610695 missense probably benign 0.02
R1707:Nasp UTSW 4 116618936 missense probably damaging 0.99
R1945:Nasp UTSW 4 116622768 missense possibly damaging 0.62
R2061:Nasp UTSW 4 116611126 missense probably benign 0.12
R4983:Nasp UTSW 4 116602185 missense probably damaging 0.99
R5064:Nasp UTSW 4 116611970 critical splice donor site probably null
R5687:Nasp UTSW 4 116605805 intron probably benign
R5713:Nasp UTSW 4 116614361 missense probably benign 0.34
R5839:Nasp UTSW 4 116602091 critical splice donor site probably null
R6145:Nasp UTSW 4 116611077 missense probably benign 0.19
R6159:Nasp UTSW 4 116603889 splice site probably null
R6234:Nasp UTSW 4 116622782 missense possibly damaging 0.51
R6286:Nasp UTSW 4 116604788 missense probably damaging 1.00
R6899:Nasp UTSW 4 116604333 missense probably damaging 1.00
R7276:Nasp UTSW 4 116614349 missense probably damaging 1.00
R7412:Nasp UTSW 4 116610588 missense possibly damaging 0.85
R7763:Nasp UTSW 4 116612033 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAATTAGACATGGGATTTCACGTAT -3'
(R):5'- GAAGCTCATTCTCAGTCATCCTG -3'

Sequencing Primer
(F):5'- GACATGGGATTTCACGTATATTAGG -3'
(R):5'- CTGGAGCTCACTTTGTAGACCAG -3'
Posted On2018-05-21