Incidental Mutation 'R6483:Arhgef10l'
ID517199
Institutional Source Beutler Lab
Gene Symbol Arhgef10l
Ensembl Gene ENSMUSG00000040964
Gene NameRho guanine nucleotide exchange factor (GEF) 10-like
Synonyms2810441C07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location140514485-140666012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140616915 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 12 (I12K)
Ref Sequence ENSEMBL: ENSMUSP00000101425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039204] [ENSMUST00000069623] [ENSMUST00000097820] [ENSMUST00000105799] [ENSMUST00000143614] [ENSMUST00000154979]
Predicted Effect probably damaging
Transcript: ENSMUST00000039204
AA Change: I12K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040531
Gene: ENSMUSG00000040964
AA Change: I12K

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 748 3e-82 BLAST
low complexity region 821 833 N/A INTRINSIC
low complexity region 864 876 N/A INTRINSIC
Blast:WD40 1217 1270 8e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000069623
AA Change: I12K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066249
Gene: ENSMUSG00000040964
AA Change: I12K

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 714 5e-80 BLAST
low complexity region 787 799 N/A INTRINSIC
low complexity region 830 842 N/A INTRINSIC
Blast:WD40 1183 1236 7e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000097820
AA Change: I12K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095431
Gene: ENSMUSG00000040964
AA Change: I12K

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 709 3e-82 BLAST
low complexity region 782 794 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
Blast:WD40 1178 1231 6e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105799
AA Change: I12K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101425
Gene: ENSMUSG00000040964
AA Change: I12K

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 753 5e-80 BLAST
low complexity region 826 838 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Blast:WD40 1222 1275 8e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000143614
AA Change: I12K

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120437
Gene: ENSMUSG00000040964
AA Change: I12K

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000154979
AA Change: I12K
SMART Domains Protein: ENSMUSP00000122667
Gene: ENSMUSG00000040964
AA Change: I12K

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RhoGEF subfamily of RhoGTPases. Members of this subfamily are activated by specific guanine nucleotide exchange factors (GEFs) and are involved in signal transduction. The encoded protein shows cytosolic distribution. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Arhgef10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Arhgef10l APN 4 140570338 missense probably damaging 0.98
IGL01732:Arhgef10l APN 4 140580415 missense probably damaging 0.99
IGL01988:Arhgef10l APN 4 140578361 splice site probably benign
IGL02031:Arhgef10l APN 4 140575345 missense probably damaging 1.00
IGL02253:Arhgef10l APN 4 140544284 nonsense probably null
IGL02445:Arhgef10l APN 4 140547007 missense probably benign 0.19
IGL02619:Arhgef10l APN 4 140594193 missense probably benign 0.07
IGL02798:Arhgef10l APN 4 140565130 critical splice donor site probably null
IGL03064:Arhgef10l APN 4 140579279 missense probably damaging 1.00
IGL03178:Arhgef10l APN 4 140544428 missense possibly damaging 0.92
IGL03236:Arhgef10l APN 4 140611360 missense probably damaging 1.00
IGL03352:Arhgef10l APN 4 140583931 start codon destroyed probably null 0.99
PIT4494001:Arhgef10l UTSW 4 140565211 missense probably damaging 0.98
R0057:Arhgef10l UTSW 4 140611218 splice site probably benign
R0062:Arhgef10l UTSW 4 140552532 missense probably damaging 1.00
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0114:Arhgef10l UTSW 4 140583883 missense probably benign 0.17
R0334:Arhgef10l UTSW 4 140583926 nonsense probably null
R0742:Arhgef10l UTSW 4 140536845 missense probably damaging 1.00
R1017:Arhgef10l UTSW 4 140515306 missense probably damaging 0.99
R1166:Arhgef10l UTSW 4 140575270 unclassified probably benign
R1397:Arhgef10l UTSW 4 140544443 missense probably damaging 0.98
R1521:Arhgef10l UTSW 4 140515438 missense possibly damaging 0.95
R1707:Arhgef10l UTSW 4 140564289 missense probably damaging 1.00
R1793:Arhgef10l UTSW 4 140515373 missense probably damaging 0.97
R2018:Arhgef10l UTSW 4 140544384 missense probably damaging 1.00
R2093:Arhgef10l UTSW 4 140570290 missense possibly damaging 0.57
R2098:Arhgef10l UTSW 4 140579432 missense probably damaging 1.00
R2310:Arhgef10l UTSW 4 140593118 missense probably damaging 1.00
R2879:Arhgef10l UTSW 4 140515287 missense probably benign 0.09
R2883:Arhgef10l UTSW 4 140516802 missense probably benign 0.02
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3861:Arhgef10l UTSW 4 140515487 missense possibly damaging 0.94
R4049:Arhgef10l UTSW 4 140515451 missense probably benign 0.05
R4322:Arhgef10l UTSW 4 140542726 missense probably benign 0.07
R4707:Arhgef10l UTSW 4 140536883 missense possibly damaging 0.63
R5395:Arhgef10l UTSW 4 140570290 missense probably benign 0.16
R5720:Arhgef10l UTSW 4 140581619 small deletion probably benign
R6066:Arhgef10l UTSW 4 140577080 missense probably damaging 1.00
R6190:Arhgef10l UTSW 4 140542762 missense possibly damaging 0.90
R6464:Arhgef10l UTSW 4 140586815 missense probably benign 0.05
R6476:Arhgef10l UTSW 4 140611382 missense probably damaging 1.00
R6478:Arhgef10l UTSW 4 140542757 missense possibly damaging 0.91
R6631:Arhgef10l UTSW 4 140517747 intron probably benign
R6721:Arhgef10l UTSW 4 140570344 missense probably damaging 1.00
R6890:Arhgef10l UTSW 4 140544419 missense probably damaging 1.00
R7098:Arhgef10l UTSW 4 140580911 missense probably benign 0.01
R7100:Arhgef10l UTSW 4 140516815 missense possibly damaging 0.60
R7117:Arhgef10l UTSW 4 140564186 critical splice donor site probably null
R7195:Arhgef10l UTSW 4 140611410 missense probably benign
R7222:Arhgef10l UTSW 4 140521269 missense probably damaging 1.00
R7397:Arhgef10l UTSW 4 140562804 missense probably damaging 1.00
R7776:Arhgef10l UTSW 4 140575331 missense probably damaging 1.00
R7801:Arhgef10l UTSW 4 140544267 missense probably benign 0.00
R7811:Arhgef10l UTSW 4 140515024 missense possibly damaging 0.63
R7832:Arhgef10l UTSW 4 140578305 missense possibly damaging 0.90
R7849:Arhgef10l UTSW 4 140583934 critical splice acceptor site probably null
R7915:Arhgef10l UTSW 4 140578305 missense possibly damaging 0.90
R7932:Arhgef10l UTSW 4 140583934 critical splice acceptor site probably null
Z1088:Arhgef10l UTSW 4 140581735 missense possibly damaging 0.53
Z1177:Arhgef10l UTSW 4 140516772 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGCTCATCTCTGCAGGTGATC -3'
(R):5'- ATGATTTATACCGGATGGAGGCC -3'

Sequencing Primer
(F):5'- ATCTCTGCAGGTGATCTTAGGCAAC -3'
(R):5'- CTTTCTGGGGCTGCCGG -3'
Posted On2018-05-21