Incidental Mutation 'R6483:Tada2b'
ID517200
Institutional Source Beutler Lab
Gene Symbol Tada2b
Ensembl Gene ENSMUSG00000029196
Gene Nametranscriptional adaptor 2B
SynonymsLOC231151
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location36473670-36484285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36476685 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 183 (T183M)
Ref Sequence ENSEMBL: ENSMUSP00000031097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031097] [ENSMUST00000031099] [ENSMUST00000119916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031097
AA Change: T183M

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031097
Gene: ENSMUSG00000029196
AA Change: T183M

DomainStartEndE-ValueType
ZnF_ZZ 3 46 2.64e-5 SMART
SANT 66 116 1.75e-9 SMART
low complexity region 138 154 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 306 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031099
SMART Domains Protein: ENSMUSP00000031099
Gene: ENSMUSG00000029198

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:GrpE 32 215 5.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119916
AA Change: T108M

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114124
Gene: ENSMUSG00000029196
AA Change: T108M

DomainStartEndE-ValueType
Blast:SANT 16 41 2e-10 BLAST
low complexity region 63 79 N/A INTRINSIC
low complexity region 158 185 N/A INTRINSIC
low complexity region 231 250 N/A INTRINSIC
Meta Mutation Damage Score 0.1664 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TADA2B functions as a transcriptional adaptor protein that potentiates transcription through coordination of histone acetyltransferase (HAT) activity and by linking activation factors to basal transcriptional machinery (Barlev et al., 2003 [PubMed 12972612]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Tada2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Tada2b APN 5 36476073 missense probably damaging 0.99
IGL01453:Tada2b APN 5 36476342 missense probably damaging 1.00
R1654:Tada2b UTSW 5 36483795 missense probably damaging 1.00
R2019:Tada2b UTSW 5 36483906 missense probably damaging 1.00
R2337:Tada2b UTSW 5 36476914 missense probably benign 0.17
R3765:Tada2b UTSW 5 36476417 missense probably benign
R3766:Tada2b UTSW 5 36476417 missense probably benign
R5099:Tada2b UTSW 5 36476400 missense probably benign 0.12
R6154:Tada2b UTSW 5 36476664 missense probably damaging 0.98
R6285:Tada2b UTSW 5 36476842 missense probably damaging 1.00
R7265:Tada2b UTSW 5 36476608 missense probably damaging 1.00
R7318:Tada2b UTSW 5 36483987 missense probably benign
R7346:Tada2b UTSW 5 36476836 missense possibly damaging 0.70
R7523:Tada2b UTSW 5 36476767 missense probably benign 0.00
R7587:Tada2b UTSW 5 36476767 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGAACTGGTAGAGTGGCC -3'
(R):5'- CATGGGAACTTGGGCAAAGC -3'

Sequencing Primer
(F):5'- CGTAGTTTGAGCCGCAGC -3'
(R):5'- GCCTGCATCCCTGACAC -3'
Posted On2018-05-21