Incidental Mutation 'R6483:Gm43302'
ID517202
Institutional Source Beutler Lab
Gene Symbol Gm43302
Ensembl Gene ENSMUSG00000079362
Gene Namepredicted gene 43302
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105214907-105293695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105275860 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 416 (M416L)
Ref Sequence ENSEMBL: ENSMUSP00000142518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000196520] [ENSMUST00000200045]
Predicted Effect probably benign
Transcript: ENSMUST00000050011
AA Change: M416L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362
AA Change: M416L

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196520
AA Change: M416L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142518
Gene: ENSMUSG00000104713
AA Change: M416L

DomainStartEndE-ValueType
Pfam:GBP 16 279 2.8e-124 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199944
Predicted Effect probably benign
Transcript: ENSMUST00000200045
SMART Domains Protein: ENSMUSP00000142994
Gene: ENSMUSG00000104713

DomainStartEndE-ValueType
Pfam:GBP 16 62 7.4e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Gm43302
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Gm43302 UTSW 5 105276844 missense probably benign 0.12
R0066:Gm43302 UTSW 5 105290900 missense probably damaging 1.00
R0764:Gm43302 UTSW 5 105280489 missense probably benign
R1400:Gm43302 UTSW 5 105274756 missense probably damaging 1.00
R1421:Gm43302 UTSW 5 105217349 missense probably benign
R1539:Gm43302 UTSW 5 105274769 missense probably benign 0.02
R1774:Gm43302 UTSW 5 105275794 missense probably benign 0.01
R1842:Gm43302 UTSW 5 105277736 missense probably benign 0.01
R2011:Gm43302 UTSW 5 105290980 missense probably damaging 1.00
R2131:Gm43302 UTSW 5 105274744 missense probably damaging 0.99
R2174:Gm43302 UTSW 5 105274350 missense probably benign 0.12
R3687:Gm43302 UTSW 5 105280266 missense probably damaging 1.00
R5322:Gm43302 UTSW 5 105217481 missense probably benign 0.00
R5396:Gm43302 UTSW 5 105280089 nonsense probably null
R5668:Gm43302 UTSW 5 105275812 missense probably benign
R5723:Gm43302 UTSW 5 105217486 missense possibly damaging 0.89
R6073:Gm43302 UTSW 5 105290959 missense probably damaging 0.96
R6159:Gm43302 UTSW 5 105289028 missense probably benign 0.11
R6225:Gm43302 UTSW 5 105277739 nonsense probably null
R6537:Gm43302 UTSW 5 105290995 missense possibly damaging 0.94
R6678:Gm43302 UTSW 5 105290954 missense probably benign 0.14
R6889:Gm43302 UTSW 5 105280138 missense probably benign 0.00
R7163:Gm43302 UTSW 5 105293627 splice site probably null
R7790:Gm43302 UTSW 5 105277825 missense probably benign 0.03
R7893:Gm43302 UTSW 5 105289025 nonsense probably null
R8047:Gm43302 UTSW 5 105274757 missense possibly damaging 0.74
RF014:Gm43302 UTSW 5 105274757 missense possibly damaging 0.94
Z1177:Gm43302 UTSW 5 105276796 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAAATGTTCCCTGCTCCTC -3'
(R):5'- CCTGGAATGCTTTCTCATTGG -3'

Sequencing Primer
(F):5'- CCCCTTCACCCCTTTCCTATG -3'
(R):5'- GCTTTCTCATTGGAAATAAGTTGGC -3'
Posted On2018-05-21