Incidental Mutation 'R6483:Klrb1c'
List |< first << previous [record 29 of 48] next >> last >|
ID517205
Institutional Source Beutler Lab
Gene Symbol Klrb1c
Ensembl Gene ENSMUSG00000030325
Gene Namekiller cell lectin-like receptor subfamily B member 1C
SynonymsNK-RP1, Nk1.1, Nk1, Ly-59, Ly59, Ly55c, CD161, Nkrp1-c, Nk-1, NKR-P1C, NK-1.1, Nk-1.2, NKR-P1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location128778485-128789215 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128784185 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 160 (S160P)
Ref Sequence ENSEMBL: ENSMUSP00000134504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167691] [ENSMUST00000174404] [ENSMUST00000174865] [ENSMUST00000204394] [ENSMUST00000204423] [ENSMUST00000204677] [ENSMUST00000204756]
Predicted Effect probably benign
Transcript: ENSMUST00000167691
AA Change: S157P

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127297
Gene: ENSMUSG00000030325
AA Change: S157P

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
CLECT 139 256 1.65e-25 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000134184
Gene: ENSMUSG00000030325
AA Change: S107P

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
CLECT 90 207 1.65e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174404
AA Change: S160P

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134504
Gene: ENSMUSG00000030325
AA Change: S160P

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
CLECT 142 259 1.65e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174865
SMART Domains Protein: ENSMUSP00000134055
Gene: ENSMUSG00000030325

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204394
AA Change: S112P

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000145481
Gene: ENSMUSG00000107872
AA Change: S112P

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 94 211 8.5e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204423
SMART Domains Protein: ENSMUSP00000145327
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
CLECT 94 211 8.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204677
SMART Domains Protein: ENSMUSP00000145287
Gene: ENSMUSG00000107872

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
PDB:3M9Z|A 89 144 2e-30 PDB
SCOP:d1e87a_ 94 143 2e-12 SMART
Blast:CLECT 94 144 3e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204756
AA Change: S103P

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144777
Gene: ENSMUSG00000107872
AA Change: S103P

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
CLECT 85 185 1e-14 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: This locus controls an antigen on natural killer cells. The a allele determines the Nk1.1 antigen in strains CE, C57BL/6, C57BR/cd, C57L, C58, DBA/1, MA/My, NZB, SJL, SM and B10.D2. The b allele determines the Nk1.2 antigen in strains CBA/J, BALB/c, C3H/He, A/J, DBA/2, LP and 129. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Klrb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02636:Klrb1c APN 6 128788552 missense probably benign 0.01
Freakish UTSW 6 128784185 missense probably benign 0.38
R3157_klrb1c_539 UTSW 6 128784739 missense possibly damaging 0.88
Unnatural UTSW 6 128784211 missense probably benign 0.09
wacky UTSW 6 128780343 missense probably damaging 1.00
Weird UTSW 6 128784257 missense probably benign 0.00
Wild UTSW 6 128786005 missense probably benign 0.09
R0463:Klrb1c UTSW 6 128780403 missense probably benign 0.07
R3157:Klrb1c UTSW 6 128784739 missense possibly damaging 0.88
R3779:Klrb1c UTSW 6 128780343 missense probably damaging 1.00
R5111:Klrb1c UTSW 6 128786005 missense probably benign 0.09
R5149:Klrb1c UTSW 6 128783707 missense probably benign 0.07
R5196:Klrb1c UTSW 6 128780299 missense probably benign 0.00
R5568:Klrb1c UTSW 6 128788914 intron probably benign
R5620:Klrb1c UTSW 6 128784743 missense possibly damaging 0.67
R6000:Klrb1c UTSW 6 128784157 missense probably damaging 1.00
R6854:Klrb1c UTSW 6 128788418 missense possibly damaging 0.87
R7283:Klrb1c UTSW 6 128784257 missense probably benign 0.00
R7697:Klrb1c UTSW 6 128780310 missense probably benign 0.02
R7946:Klrb1c UTSW 6 128789109 intron probably benign
R8789:Klrb1c UTSW 6 128784185 missense probably benign 0.38
Z1177:Klrb1c UTSW 6 128788447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCACATGTCCAATTAGTC -3'
(R):5'- CCTGCACATGTTAATAAAAGTGTGGG -3'

Sequencing Primer
(F):5'- CCAATTAGTCTTTCACACTATGAGC -3'
(R):5'- AGTGTGGGTTAGTAAAAACTACTGTG -3'
Posted On2018-05-21