Incidental Mutation 'R6483:Olfr519'
ID517209
Institutional Source Beutler Lab
Gene Symbol Olfr519
Ensembl Gene ENSMUSG00000066239
Gene Nameolfactory receptor 519
SynonymsGA_x6K02T2PBJ9-11224559-11223615, MOR268-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108893461-108894420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108894111 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 99 (V99M)
Ref Sequence ENSEMBL: ENSMUSP00000144271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084752] [ENSMUST00000202706]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084752
AA Change: V104M

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081804
Gene: ENSMUSG00000066239
AA Change: V104M

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.3e-59 PFAM
Pfam:7TM_GPCR_Srsx 40 310 3.3e-6 PFAM
Pfam:7tm_1 46 305 3.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202706
AA Change: V99M

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144271
Gene: ENSMUSG00000066239
AA Change: V99M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.1e-59 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-5 PFAM
Pfam:7tm_1 41 300 1.2e-24 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Olfr519
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Olfr519 APN 7 108894085 missense probably benign 0.22
IGL02043:Olfr519 APN 7 108893839 nonsense probably null
PIT4382001:Olfr519 UTSW 7 108894102 missense probably damaging 1.00
R1183:Olfr519 UTSW 7 108893741 missense probably damaging 1.00
R1596:Olfr519 UTSW 7 108893879 missense probably damaging 1.00
R1647:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R1648:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R3952:Olfr519 UTSW 7 108893982 missense probably benign 0.00
R4611:Olfr519 UTSW 7 108894117 missense probably damaging 1.00
R4723:Olfr519 UTSW 7 108893821 missense probably benign 0.09
R5838:Olfr519 UTSW 7 108894085 missense probably benign 0.22
R6516:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R7353:Olfr519 UTSW 7 108894222 missense probably damaging 1.00
R7748:Olfr519 UTSW 7 108894078 missense probably benign 0.22
Z1088:Olfr519 UTSW 7 108893773 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTGGTCACAGTAGGGAAAGC -3'
(R):5'- TGACTGTGTTGGGAAATGCC -3'

Sequencing Primer
(F):5'- TGTGACTGACAAAACAGCTGTC -3'
(R):5'- GTTGGGAAATGCCATCATTATCACC -3'
Posted On2018-05-21