Incidental Mutation 'R6483:Dnajc13'
ID517215
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene NameDnaJ heat shock protein family (Hsp40) member C13
SynonymsLOC382100, D030002L11Rik, Rme8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location104151282-104262930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104207804 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 798 (D798E)
Ref Sequence ENSEMBL: ENSMUSP00000035170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
Predicted Effect probably damaging
Transcript: ENSMUST00000035170
AA Change: D798E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: D798E

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186788
AA Change: D803E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: D803E

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188592
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCAAGCAAAGACTAGAATTTCCC -3'
(R):5'- CCTGCACAGCCTGAAATTGG -3'

Sequencing Primer
(F):5'- CCGTGAAGACAAAGCTGT -3'
(R):5'- CTGCACAGCCTGAAATTGGACATATG -3'
Posted On2018-05-21