Mutagenetix > Incidental Mutations

Incidental Mutation 'R6483:Dnajc13'

517215

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R6483 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104207804 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 798 (D798E)

Ref Sequence

ENSEMBL: ENSMUSP00000035170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035170
AA Change: D798E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: D798E

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186788
AA Change: D803E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: D803E

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188592

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr8	T	G	14: 29,978,581	L39R	possibly damaging	Het
Amer3	T	C	1: 34,587,690	S337P	probably damaging	Het
Arhgef10l	A	T	4: 140,616,915	I12K	probably damaging	Het
Atp2b4	A	G	1: 133,729,880	V624A	possibly damaging	Het
BB014433	A	T	8: 15,042,208	L215Q	probably benign	Het
Bod1l	A	G	5: 41,821,082	V963A	probably benign	Het
Bpifa6	T	C	2: 153,990,434	L287S	probably benign	Het
Bsnd	A	T	4: 106,488,015	L78Q	probably damaging	Het
C1qtnf3	T	C	15: 10,958,070		probably null	Het
Ccdc180	T	G	4: 45,921,950	V1008G	probably benign	Het
Ccl1	T	G	11: 82,178,034	D59A	possibly damaging	Het
Cfap58	T	C	19: 47,983,452	I607T	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cntnap4	C	T	8: 112,757,473	P386L	possibly damaging	Het
Col1a1	G	A	11: 94,942,618		probably null	Het
Eml6	T	G	11: 29,749,875	I1754L	probably benign	Het
Ercc8	T	A	13: 108,183,810	V310D	probably damaging	Het
Fat2	G	A	11: 55,296,345	T1225I	probably damaging	Het
Gba	A	G	3: 89,208,603	Y510C	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm43302	T	A	5: 105,275,860	M416L	probably benign	Het
Grxcr2	A	T	18: 41,991,890	V151E	probably benign	Het
Gtf2ird2	A	G	5: 134,211,225	N296S	probably benign	Het
Herc1	T	A	9: 66,448,529	I2354N	possibly damaging	Het
Inhbc	G	A	10: 127,357,440	R236*	probably null	Het
Itpr2	T	C	6: 146,112,477	D2607G	possibly damaging	Het
Kcnh7	T	A	2: 62,845,774	D298V	probably benign	Het
Klrb1c	A	G	6: 128,784,185	S160P	probably benign	Het
Mrgpra2a	C	G	7: 47,426,689	E274Q	probably benign	Het
Muc5ac	T	A	7: 141,802,854	F1059L	probably benign	Het
Naglu	T	C	11: 101,071,181	I160T	probably damaging	Het
Nasp	A	T	4: 116,618,948	L47Q	probably damaging	Het
Olfr1037	C	A	2: 86,085,440	M112I	probably benign	Het
Olfr519	C	T	7: 108,894,111	V99M	possibly damaging	Het
Olfr686	T	C	7: 105,204,293	T17A	probably benign	Het
Opa1	C	T	16: 29,628,707	T873I	possibly damaging	Het
Pttg1	A	G	11: 43,424,844	F48L	probably damaging	Het
Rho	T	C	6: 115,932,257	F85L	possibly damaging	Het
Rnasel	T	C	1: 153,754,686	V316A	probably benign	Het
Slc36a3	A	G	11: 55,135,263	I243T	probably benign	Het
Tada2b	G	A	5: 36,476,685	T183M	possibly damaging	Het
Tbc1d22a	A	G	15: 86,301,567	M286V	possibly damaging	Het
Trim69	G	T	2: 122,167,600	E18*	probably null	Het
Ttn	T	C	2: 76,942,050	T2503A	possibly damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Zfp654	T	A	16: 64,791,947	N192I	possibly damaging	Het
Zfp809	G	A	9: 22,236,244	R58H	probably benign	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0558:Dnajc13	UTSW	9	104201952	critical splice acceptor site	probably null
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2066:Dnajc13	UTSW	9	104221441	missense	probably benign	0.01
R2206:Dnajc13	UTSW	9	104203518	missense	probably damaging	1.00
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4662:Dnajc13	UTSW	9	104207758	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5177:Dnajc13	UTSW	9	104230986	missense	probably benign	0.39
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5452:Dnajc13	UTSW	9	104192114	missense	probably benign	0.01
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R5982:Dnajc13	UTSW	9	104184615	missense	possibly damaging	0.77
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R6962:Dnajc13	UTSW	9	104181009	missense	probably benign	0.02
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTCAAGCAAAGACTAGAATTTCCC -3'
(R):5'- CCTGCACAGCCTGAAATTGG -3'

Sequencing Primer
(F):5'- CCGTGAAGACAAAGCTGT -3'
(R):5'- CTGCACAGCCTGAAATTGGACATATG -3'

Posted On

2018-05-21