Incidental Mutation 'R6483:Inhbc'
ID517216
Institutional Source Beutler Lab
Gene Symbol Inhbc
Ensembl Gene ENSMUSG00000025405
Gene Nameinhibin beta-C
Synonymsactivin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127356322-127370431 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 127357440 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 236 (R236*)
Ref Sequence ENSEMBL: ENSMUSP00000026472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026472] [ENSMUST00000059718]
Predicted Effect probably null
Transcript: ENSMUST00000026472
AA Change: R236*
SMART Domains Protein: ENSMUSP00000026472
Gene: ENSMUSG00000025405
AA Change: R236*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TGFB 247 352 7.32e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059718
SMART Domains Protein: ENSMUSP00000053977
Gene: ENSMUSG00000047492

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
TGFB 247 350 3.63e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219640
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of homodimeric and heterodimeric activin complexes. The heterodimeric complex may function in the inhibition of activin A signaling. Transgenic mice overexpressing this gene exhibit defects in testis, liver and prostate. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null mutation display decreased serum albumin in females but are fertile with normal liver and reproductive morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Inhbc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Inhbc APN 10 127370099 missense probably damaging 1.00
IGL02114:Inhbc APN 10 127370102 missense probably benign 0.00
LCD18:Inhbc UTSW 10 127367140 intron probably benign
R0042:Inhbc UTSW 10 127357433 missense probably benign 0.17
R0760:Inhbc UTSW 10 127357368 missense probably damaging 1.00
R1339:Inhbc UTSW 10 127357641 missense probably benign
R1754:Inhbc UTSW 10 127370293 missense possibly damaging 0.84
R1867:Inhbc UTSW 10 127357547 missense probably benign 0.01
R2902:Inhbc UTSW 10 127357752 missense probably benign
R4622:Inhbc UTSW 10 127357277 missense probably benign 0.26
R5128:Inhbc UTSW 10 127357742 missense probably benign 0.12
R5285:Inhbc UTSW 10 127357400 missense probably damaging 1.00
R5423:Inhbc UTSW 10 127357427 missense probably damaging 1.00
R5807:Inhbc UTSW 10 127357542 nonsense probably null
R5815:Inhbc UTSW 10 127357449 missense probably benign 0.01
R7423:Inhbc UTSW 10 127357406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGAGCAGATTCAGCACTG -3'
(R):5'- TACGTGGTGCAGGTGAATGC -3'

Sequencing Primer
(F):5'- CACTGCAGTGTGAAAGGAGGC -3'
(R):5'- TGCAGGTGAATGCCAGTG -3'
Posted On2018-05-21