Incidental Mutation 'R6483:Pttg1'
ID517218
Institutional Source Beutler Lab
Gene Symbol Pttg1
Ensembl Gene ENSMUSG00000020415
Gene Namepituitary tumor-transforming gene 1
SynonymsPTTG, securin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location43420250-43426251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43424844 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 48 (F48L)
Ref Sequence ENSEMBL: ENSMUSP00000119554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020685] [ENSMUST00000020687] [ENSMUST00000101340] [ENSMUST00000117446] [ENSMUST00000118368] [ENSMUST00000121638] [ENSMUST00000140434] [ENSMUST00000152115]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020685
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020685
Gene: ENSMUSG00000020415
AA Change: F48L

DomainStartEndE-ValueType
Pfam:Securin 1 186 1.4e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000020687
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020687
Gene: ENSMUSG00000020415
AA Change: F48L

DomainStartEndE-ValueType
Pfam:Securin 1 184 1.9e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101340
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098894
Gene: ENSMUSG00000020415
AA Change: F48L

DomainStartEndE-ValueType
Pfam:Securin 1 181 3.1e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117446
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112841
Gene: ENSMUSG00000020415
AA Change: F48L

DomainStartEndE-ValueType
Pfam:Securin 1 186 1.4e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118368
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112834
Gene: ENSMUSG00000020415
AA Change: F48L

DomainStartEndE-ValueType
Pfam:Securin 1 181 3.1e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121638
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112815
Gene: ENSMUSG00000020415
AA Change: F48L

DomainStartEndE-ValueType
Pfam:Securin 1 181 3.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140434
SMART Domains Protein: ENSMUSP00000122019
Gene: ENSMUSG00000020415

DomainStartEndE-ValueType
Pfam:Securin 1 97 1.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150726
Predicted Effect probably damaging
Transcript: ENSMUST00000152115
AA Change: F48L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119554
Gene: ENSMUSG00000020415
AA Change: F48L

DomainStartEndE-ValueType
Pfam:Securin 1 122 1.7e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show testicular and splenic hypoplasia, thymic hyperplasia, thrombocytopenia, aberrant cell cycle progression, chromosome instability, premature centromere division, reduced female fertility, reduced pancreatic betacell mass and sexually-dimorphic diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Pttg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1826:Pttg1 UTSW 11 43420366 missense probably damaging 0.98
R2433:Pttg1 UTSW 11 43420351 missense probably damaging 0.98
R4448:Pttg1 UTSW 11 43424690 intron probably benign
R4663:Pttg1 UTSW 11 43424850 nonsense probably null
R7104:Pttg1 UTSW 11 43421149 missense probably benign 0.12
R7289:Pttg1 UTSW 11 43421089 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGTATTCATCTACAGCTACGTATAC -3'
(R):5'- CCCAAATGAGGCACAGGTTTG -3'

Sequencing Primer
(F):5'- AATAAACTTTTCTTAAGTGCCAACAC -3'
(R):5'- CAACAGTCAAGGCCTTAG -3'
Posted On2018-05-21