Mutagenetix > Incidental Mutation

Incidental Mutation 'R6483:Pttg1'

517218

Institutional Source

Beutler Lab

Gene Symbol

Pttg1

Ensembl Gene

ENSMUSG00000020415

Gene Name

pituitary tumor-transforming gene 1

Synonyms

PTTG, securin

MMRRC Submission

044615-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6483 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43311077-43317078 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43315671 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 48 (F48L)

Ref Sequence

ENSEMBL: ENSMUSP00000119554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020685] [ENSMUST00000020687] [ENSMUST00000101340] [ENSMUST00000117446] [ENSMUST00000118368] [ENSMUST00000121638] [ENSMUST00000140434] [ENSMUST00000152115]

AlphaFold

Q9CQJ7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020685
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020685
Gene: ENSMUSG00000020415
AA Change: F48L

Domain	Start	End	E-Value	Type
Pfam:Securin	1	186	1.4e-41	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020687
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020687
Gene: ENSMUSG00000020415
AA Change: F48L

Domain	Start	End	E-Value	Type
Pfam:Securin	1	184	1.9e-40	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101340
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000098894
Gene: ENSMUSG00000020415
AA Change: F48L

Domain	Start	End	E-Value	Type
Pfam:Securin	1	181	3.1e-41	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117446
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112841
Gene: ENSMUSG00000020415
AA Change: F48L

Domain	Start	End	E-Value	Type
Pfam:Securin	1	186	1.4e-41	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118368
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112834
Gene: ENSMUSG00000020415
AA Change: F48L

Domain	Start	End	E-Value	Type
Pfam:Securin	1	181	3.1e-41	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121638
AA Change: F48L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112815
Gene: ENSMUSG00000020415
AA Change: F48L

Domain	Start	End	E-Value	Type
Pfam:Securin	1	181	3.1e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140434

SMART Domains

Protein: ENSMUSP00000122019
Gene: ENSMUSG00000020415

Domain	Start	End	E-Value	Type
Pfam:Securin	1	97	1.6e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000152115
AA Change: F48L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119554
Gene: ENSMUSG00000020415
AA Change: F48L

Domain	Start	End	E-Value	Type
Pfam:Securin	1	122	1.7e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148130

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150726

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show testicular and splenic hypoplasia, thymic hyperplasia, thrombocytopenia, aberrant cell cycle progression, chromosome instability, premature centromere division, reduced female fertility, reduced pancreatic betacell mass and sexually-dimorphic diabetes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr8	T	G	14: 29,700,538 (GRCm39)	L39R	possibly damaging	Het
Amer3	T	C	1: 34,626,771 (GRCm39)	S337P	probably damaging	Het
Arhgef10l	A	T	4: 140,344,226 (GRCm39)	I12K	probably damaging	Het
Atp2b4	A	G	1: 133,657,618 (GRCm39)	V624A	possibly damaging	Het
BB014433	A	T	8: 15,092,208 (GRCm39)	L215Q	probably benign	Het
Bod1l	A	G	5: 41,978,425 (GRCm39)	V963A	probably benign	Het
Bpifa6	T	C	2: 153,832,354 (GRCm39)	L287S	probably benign	Het
Bsnd	A	T	4: 106,345,212 (GRCm39)	L78Q	probably damaging	Het
C1qtnf3	T	C	15: 10,958,156 (GRCm39)		probably null	Het
Ccdc180	T	G	4: 45,921,950 (GRCm39)	V1008G	probably benign	Het
Ccl1	T	G	11: 82,068,860 (GRCm39)	D59A	possibly damaging	Het
Cfap58	T	C	19: 47,971,891 (GRCm39)	I607T	probably benign	Het
Chd1l	G	A	3: 97,494,483 (GRCm39)	A399V	probably damaging	Het
Cntnap4	C	T	8: 113,484,105 (GRCm39)	P386L	possibly damaging	Het
Col1a1	G	A	11: 94,833,444 (GRCm39)		probably null	Het
Dnajc13	A	T	9: 104,085,003 (GRCm39)	D798E	probably damaging	Het
Eml6	T	G	11: 29,699,875 (GRCm39)	I1754L	probably benign	Het
Ercc8	T	A	13: 108,320,344 (GRCm39)	V310D	probably damaging	Het
Fat2	G	A	11: 55,187,171 (GRCm39)	T1225I	probably damaging	Het
Gba1	A	G	3: 89,115,910 (GRCm39)	Y510C	probably damaging	Het
Gm11595	G	A	11: 99,663,381 (GRCm39)	R100C	unknown	Het
Gm43302	T	A	5: 105,423,726 (GRCm39)	M416L	probably benign	Het
Grxcr2	A	T	18: 42,124,955 (GRCm39)	V151E	probably benign	Het
Gtf2ird2	A	G	5: 134,240,066 (GRCm39)	N296S	probably benign	Het
Herc1	T	A	9: 66,355,811 (GRCm39)	I2354N	possibly damaging	Het
Inhbc	G	A	10: 127,193,309 (GRCm39)	R236*	probably null	Het
Itpr2	T	C	6: 146,013,975 (GRCm39)	D2607G	possibly damaging	Het
Kcnh7	T	A	2: 62,676,118 (GRCm39)	D298V	probably benign	Het
Klrb1c	A	G	6: 128,761,148 (GRCm39)	S160P	probably benign	Het
Mrgpra2a	C	G	7: 47,076,437 (GRCm39)	E274Q	probably benign	Het
Muc5ac	T	A	7: 141,356,591 (GRCm39)	F1059L	probably benign	Het
Naglu	T	C	11: 100,962,007 (GRCm39)	I160T	probably damaging	Het
Nasp	A	T	4: 116,476,145 (GRCm39)	L47Q	probably damaging	Het
Opa1	C	T	16: 29,447,525 (GRCm39)	T873I	possibly damaging	Het
Or10a3n	C	T	7: 108,493,318 (GRCm39)	V99M	possibly damaging	Het
Or52x1	T	C	7: 104,853,500 (GRCm39)	T17A	probably benign	Het
Or8u10	C	A	2: 85,915,784 (GRCm39)	M112I	probably benign	Het
Rho	T	C	6: 115,909,218 (GRCm39)	F85L	possibly damaging	Het
Rnasel	T	C	1: 153,630,432 (GRCm39)	V316A	probably benign	Het
Slc36a3	A	G	11: 55,026,089 (GRCm39)	I243T	probably benign	Het
Tada2b	G	A	5: 36,634,029 (GRCm39)	T183M	possibly damaging	Het
Tbc1d22a	A	G	15: 86,185,768 (GRCm39)	M286V	possibly damaging	Het
Trim69	G	T	2: 121,998,081 (GRCm39)	E18*	probably null	Het
Ttn	T	C	2: 76,772,394 (GRCm39)	T2503A	possibly damaging	Het
Uox	C	T	3: 146,330,332 (GRCm39)	R163*	probably null	Het
Zfp654	T	A	16: 64,612,310 (GRCm39)	N192I	possibly damaging	Het
Zfp809	G	A	9: 22,147,540 (GRCm39)	R58H	probably benign	Het

Other mutations in Pttg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1826:Pttg1	UTSW	11	43,311,193 (GRCm39)	missense	probably damaging	0.98
R2433:Pttg1	UTSW	11	43,311,178 (GRCm39)	missense	probably damaging	0.98
R4448:Pttg1	UTSW	11	43,315,517 (GRCm39)	intron	probably benign
R4663:Pttg1	UTSW	11	43,315,677 (GRCm39)	nonsense	probably null
R7104:Pttg1	UTSW	11	43,311,976 (GRCm39)	missense	probably benign	0.12
R7289:Pttg1	UTSW	11	43,311,916 (GRCm39)	missense	probably benign	0.01
R7914:Pttg1	UTSW	11	43,316,421 (GRCm39)	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- GCAGTATTCATCTACAGCTACGTATAC -3'
(R):5'- CCCAAATGAGGCACAGGTTTG -3'

Sequencing Primer
(F):5'- AATAAACTTTTCTTAAGTGCCAACAC -3'
(R):5'- CAACAGTCAAGGCCTTAG -3'

Posted On

2018-05-21