Incidental Mutation 'R6483:Ercc8'
List |< first << previous [record 18 of 48] next >> last >|
ID517224
Institutional Source Beutler Lab
Gene Symbol Ercc8
Ensembl Gene ENSMUSG00000021694
Gene Nameexcision repaiross-complementing rodent repair deficiency, complementation group 8
Synonyms2810431L23Rik, 4631412O06Rik, B130065P18Rik, 2410022P04Rik, Csa, Ckn1
MMRRC Submission
Accession Numbers

Genbank: NM_028042

Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location108158731-108195364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108183810 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 310 (V310D)
Ref Sequence ENSEMBL: ENSMUSP00000059211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054835] [ENSMUST00000123657] [ENSMUST00000133957] [ENSMUST00000142931] [ENSMUST00000152634]
Predicted Effect probably damaging
Transcript: ENSMUST00000054835
AA Change: V310D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059211
Gene: ENSMUSG00000021694
AA Change: V310D

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
WD40 175 215 2.71e-10 SMART
WD40 234 273 9.24e-4 SMART
WD40 323 362 7.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123657
SMART Domains Protein: ENSMUSP00000117492
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133957
SMART Domains Protein: ENSMUSP00000116226
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 54 3e-30 PDB
Blast:WD40 28 54 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142931
SMART Domains Protein: ENSMUSP00000118154
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152634
SMART Domains Protein: ENSMUSP00000122802
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous mutation of this gene results in skin photosensitivity, increased incidence of skin tumors after UV exposure, and progressive photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Ercc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Ercc8 APN 13 108169459 missense probably damaging 1.00
IGL02074:Ercc8 APN 13 108158784 unclassified probably benign
B5639:Ercc8 UTSW 13 108160723 missense probably damaging 0.96
R0620:Ercc8 UTSW 13 108174061 critical splice donor site probably null
R1909:Ercc8 UTSW 13 108175566 nonsense probably null
R2509:Ercc8 UTSW 13 108183717 splice site probably benign
R2967:Ercc8 UTSW 13 108160714 missense probably damaging 1.00
R3857:Ercc8 UTSW 13 108194114 missense possibly damaging 0.82
R4941:Ercc8 UTSW 13 108160767 unclassified probably benign
R5585:Ercc8 UTSW 13 108175589 missense probably damaging 0.99
R6023:Ercc8 UTSW 13 108178577 missense probably damaging 1.00
R6363:Ercc8 UTSW 13 108183870 missense probably damaging 1.00
R6825:Ercc8 UTSW 13 108158809 missense probably damaging 0.97
R7151:Ercc8 UTSW 13 108187282 critical splice donor site probably null
R7166:Ercc8 UTSW 13 108169433 missense possibly damaging 0.94
R7710:Ercc8 UTSW 13 108183863 missense probably benign
R8395:Ercc8 UTSW 13 108187254 nonsense probably null
R8678:Ercc8 UTSW 13 108169493 critical splice donor site probably null
R8744:Ercc8 UTSW 13 108183773 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCCCTCTCTATTGAATGCC -3'
(R):5'- ACGAGAGAATAGAACAACTTCCTG -3'

Sequencing Primer
(F):5'- GCCATAATAAATGAAGGAAGTGTTTG -3'
(R):5'- TTTTACACTCTGAGAGTCTGGCAATC -3'
Posted On2018-05-21