Incidental Mutation 'R6483:Actr8'
ID517225
Institutional Source Beutler Lab
Gene Symbol Actr8
Ensembl Gene ENSMUSG00000015971
Gene NameARP8 actin-related protein 8
Synonyms5730542K05Rik, ARP8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6483 (G1)
Quality Score141.008
Status Validated
Chromosome14
Chromosomal Location29978337-30006354 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 29978581 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 39 (L39R)
Ref Sequence ENSEMBL: ENSMUSP00000153076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016115] [ENSMUST00000112268] [ENSMUST00000223998] [ENSMUST00000224797] [ENSMUST00000225811]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016115
AA Change: L39R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000016115
Gene: ENSMUSG00000015971
AA Change: L39R

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
ACTIN 46 621 3.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112268
SMART Domains Protein: ENSMUSP00000107887
Gene: ENSMUSG00000042682

DomainStartEndE-ValueType
Pfam:DUF2763 2 91 6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133229
Predicted Effect probably benign
Transcript: ENSMUST00000223998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224343
Predicted Effect possibly damaging
Transcript: ENSMUST00000224797
AA Change: L39R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225793
Predicted Effect probably benign
Transcript: ENSMUST00000225811
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Col1a1 G A 11: 94,942,618 probably null Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Actr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Actr8 APN 14 29988335 missense probably damaging 1.00
IGL01449:Actr8 APN 14 29990970 critical splice donor site probably null
IGL01577:Actr8 APN 14 29987275 missense probably benign
IGL02118:Actr8 APN 14 29982771 critical splice donor site probably null
IGL02647:Actr8 APN 14 29990890 missense probably damaging 1.00
IGL02659:Actr8 APN 14 29986341 missense probably damaging 1.00
IGL02696:Actr8 APN 14 29982671 missense probably benign 0.33
IGL03015:Actr8 APN 14 29986316 missense possibly damaging 0.81
IGL03335:Actr8 APN 14 29978557 missense probably benign
R0512:Actr8 UTSW 14 29978556 missense probably benign 0.00
R0735:Actr8 UTSW 14 29989712 missense probably benign 0.02
R0926:Actr8 UTSW 14 29987224 missense probably benign 0.02
R1443:Actr8 UTSW 14 29984099 missense possibly damaging 0.73
R1470:Actr8 UTSW 14 29986969 missense possibly damaging 0.90
R1470:Actr8 UTSW 14 29986969 missense possibly damaging 0.90
R1616:Actr8 UTSW 14 29982644 missense possibly damaging 0.53
R2097:Actr8 UTSW 14 29987228 missense probably damaging 0.98
R2240:Actr8 UTSW 14 29989757 missense possibly damaging 0.94
R2570:Actr8 UTSW 14 29987282 missense probably damaging 1.00
R5122:Actr8 UTSW 14 29982715 missense possibly damaging 0.95
R5439:Actr8 UTSW 14 29986995 missense probably damaging 1.00
R5697:Actr8 UTSW 14 29991673 missense possibly damaging 0.73
R5727:Actr8 UTSW 14 29990881 missense probably benign 0.01
R5860:Actr8 UTSW 14 29986285 nonsense probably null
R5988:Actr8 UTSW 14 29993073 missense possibly damaging 0.71
R6006:Actr8 UTSW 14 29984142 critical splice donor site probably null
R6009:Actr8 UTSW 14 29978497 unclassified probably benign
R6155:Actr8 UTSW 14 29978589 critical splice donor site probably null
R6190:Actr8 UTSW 14 29991717 nonsense probably null
R6329:Actr8 UTSW 14 29993084 nonsense probably null
R6517:Actr8 UTSW 14 29982716 nonsense probably null
R6562:Actr8 UTSW 14 29986454 splice site probably null
R7484:Actr8 UTSW 14 29992968 missense probably damaging 1.00
Z1177:Actr8 UTSW 14 29986401 missense probably damaging 1.00
Z1177:Actr8 UTSW 14 29987242 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGGTTCTCCTCTGACTGCTG -3'
(R):5'- CCGTTGCTAAATCGTGACGTC -3'

Sequencing Primer
(F):5'- CTCTGACTGCTGTGGCGTC -3'
(R):5'- ATCGTGACGTCTTATAGCTGAGACC -3'
Posted On2018-05-21