Mutagenetix > Incidental Mutations

Incidental Mutation 'R6483:C1qtnf3'

517226

Institutional Source

Beutler Lab

Gene Symbol

C1qtnf3

Ensembl Gene

ENSMUSG00000058914

Gene Name

C1q and tumor necrosis factor related protein 3

Synonyms

Corcs, CTRP3, 2310005P21Rik, CORS-26

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6483 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10952332-10980150 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 10958070 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106152 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022853] [ENSMUST00000110523]

Predicted Effect

probably null
Transcript: ENSMUST00000022853

SMART Domains

Protein: ENSMUSP00000022853
Gene: ENSMUSG00000058914

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	54	75	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
C1Q	111	245	2.26e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110523

SMART Domains

Protein: ENSMUSP00000106152
Gene: ENSMUSG00000058914

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	127	148	N/A	INTRINSIC
low complexity region	151	166	N/A	INTRINSIC
C1Q	184	318	2.26e-18	SMART

Meta Mutation Damage Score

0.9479

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

100% (46/46)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to collagen-induced arthritis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr8	T	G	14: 29,978,581	L39R	possibly damaging	Het
Amer3	T	C	1: 34,587,690	S337P	probably damaging	Het
Arhgef10l	A	T	4: 140,616,915	I12K	probably damaging	Het
Atp2b4	A	G	1: 133,729,880	V624A	possibly damaging	Het
BB014433	A	T	8: 15,042,208	L215Q	probably benign	Het
Bod1l	A	G	5: 41,821,082	V963A	probably benign	Het
Bpifa6	T	C	2: 153,990,434	L287S	probably benign	Het
Bsnd	A	T	4: 106,488,015	L78Q	probably damaging	Het
Ccdc180	T	G	4: 45,921,950	V1008G	probably benign	Het
Ccl1	T	G	11: 82,178,034	D59A	possibly damaging	Het
Cfap58	T	C	19: 47,983,452	I607T	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cntnap4	C	T	8: 112,757,473	P386L	possibly damaging	Het
Col1a1	G	A	11: 94,942,618		probably null	Het
Dnajc13	A	T	9: 104,207,804	D798E	probably damaging	Het
Eml6	T	G	11: 29,749,875	I1754L	probably benign	Het
Ercc8	T	A	13: 108,183,810	V310D	probably damaging	Het
Fat2	G	A	11: 55,296,345	T1225I	probably damaging	Het
Gba	A	G	3: 89,208,603	Y510C	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm43302	T	A	5: 105,275,860	M416L	probably benign	Het
Grxcr2	A	T	18: 41,991,890	V151E	probably benign	Het
Gtf2ird2	A	G	5: 134,211,225	N296S	probably benign	Het
Herc1	T	A	9: 66,448,529	I2354N	possibly damaging	Het
Inhbc	G	A	10: 127,357,440	R236*	probably null	Het
Itpr2	T	C	6: 146,112,477	D2607G	possibly damaging	Het
Kcnh7	T	A	2: 62,845,774	D298V	probably benign	Het
Klrb1c	A	G	6: 128,784,185	S160P	probably benign	Het
Mrgpra2a	C	G	7: 47,426,689	E274Q	probably benign	Het
Muc5ac	T	A	7: 141,802,854	F1059L	probably benign	Het
Naglu	T	C	11: 101,071,181	I160T	probably damaging	Het
Nasp	A	T	4: 116,618,948	L47Q	probably damaging	Het
Olfr1037	C	A	2: 86,085,440	M112I	probably benign	Het
Olfr519	C	T	7: 108,894,111	V99M	possibly damaging	Het
Olfr686	T	C	7: 105,204,293	T17A	probably benign	Het
Opa1	C	T	16: 29,628,707	T873I	possibly damaging	Het
Pttg1	A	G	11: 43,424,844	F48L	probably damaging	Het
Rho	T	C	6: 115,932,257	F85L	possibly damaging	Het
Rnasel	T	C	1: 153,754,686	V316A	probably benign	Het
Slc36a3	A	G	11: 55,135,263	I243T	probably benign	Het
Tada2b	G	A	5: 36,476,685	T183M	possibly damaging	Het
Tbc1d22a	A	G	15: 86,301,567	M286V	possibly damaging	Het
Trim69	G	T	2: 122,167,600	E18*	probably null	Het
Ttn	T	C	2: 76,942,050	T2503A	possibly damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Zfp654	T	A	16: 64,791,947	N192I	possibly damaging	Het
Zfp809	G	A	9: 22,236,244	R58H	probably benign	Het

Other mutations in C1qtnf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:C1qtnf3	APN	15	10960682	missense	probably damaging	1.00
IGL02491:C1qtnf3	APN	15	10971981	missense	possibly damaging	0.69
mimosa_pudica	UTSW	15	10958070	critical splice donor site	probably null
R0083:C1qtnf3	UTSW	15	10975632	missense	possibly damaging	0.89
R1136:C1qtnf3	UTSW	15	10978584	missense	probably damaging	0.98
R1447:C1qtnf3	UTSW	15	10952649	missense	probably damaging	1.00
R1510:C1qtnf3	UTSW	15	10975636	missense	probably benign	0.05
R4536:C1qtnf3	UTSW	15	10972027	missense	probably damaging	0.98
R5397:C1qtnf3	UTSW	15	10978541	missense	probably damaging	0.99
R5833:C1qtnf3	UTSW	15	10975630	missense	probably benign	0.06
R6555:C1qtnf3	UTSW	15	10975656	missense	probably damaging	0.99
R7324:C1qtnf3	UTSW	15	10952621	missense	probably benign	0.04
R7456:C1qtnf3	UTSW	15	10972051	missense	probably benign	0.02
R7772:C1qtnf3	UTSW	15	10958044	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- TCTCTAAGGGTGAAGGCCAG -3'
(R):5'- GAAGTGCCTCCCTTCCTGAAAC -3'

Sequencing Primer
(F):5'- AGGCCAGAAGAACTTATAACATTAAG -3'
(R):5'- CCTGAAACCTTTAGGATTCTAGGAG -3'

Posted On

2018-05-21