Incidental Mutation 'R6484:Myh7b'
ID517237
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Namemyosin, heavy chain 7B, cardiac muscle, beta
SynonymsMyh14
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6484 (G1)
Quality Score207.009
Status Validated
Chromosome2
Chromosomal Location155611212-155634307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155628643 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1032 (I1032F)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
Predicted Effect probably benign
Transcript: ENSMUST00000092995
AA Change: I1032F

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: I1032F

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154656
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,279,095 V1548A probably damaging Het
3110062M04Rik G A 6: 34,874,616 S101L probably damaging Het
Abce1 A T 8: 79,690,323 M353K probably damaging Het
Adgre4 G A 17: 55,802,036 V348M possibly damaging Het
Alg8 T C 7: 97,382,928 V228A probably benign Het
Btbd8 T C 5: 107,503,585 S115P probably benign Het
Car8 A G 4: 8,189,362 F151L probably benign Het
CN725425 A G 15: 91,260,572 Q546R probably benign Het
Col17a1 C T 19: 47,670,429 V414M possibly damaging Het
Col6a3 C A 1: 90,791,923 probably null Het
Cyp51 G A 5: 4,086,627 T389M probably benign Het
Dazap1 A G 10: 80,277,647 T126A probably benign Het
Dscc1 T A 15: 55,080,290 K395* probably null Het
Dthd1 A G 5: 62,814,332 N166S probably benign Het
Eefsec C G 6: 88,297,788 W398S probably damaging Het
Enpep T A 3: 129,321,481 H214L probably damaging Het
Esf1 T C 2: 140,158,538 I443V probably benign Het
Espl1 T C 15: 102,323,500 V1984A possibly damaging Het
Hip1 A G 5: 135,440,129 S280P probably damaging Het
Il12rb1 C T 8: 70,809,704 probably null Het
Itgax T A 7: 128,133,718 C255S probably benign Het
Kifc5b T C 17: 26,924,772 V506A probably damaging Het
Klf3 A G 5: 64,823,029 E54G probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Mctp1 A G 13: 76,688,625 I104V probably benign Het
Mdga2 T C 12: 66,630,069 E552G possibly damaging Het
Mpc1 A G 17: 8,296,956 E160G possibly damaging Het
Myh10 T A 11: 68,699,467 I76N probably damaging Het
Olfml2a G A 2: 38,959,768 V499I probably damaging Het
Olfr1311 A T 2: 112,021,419 L145* probably null Het
Olfr1458 A G 19: 13,103,067 V79A probably benign Het
Olfr91 T A 17: 37,093,266 I203F probably benign Het
P2ry12 A G 3: 59,217,333 L307P probably damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Phox2b A G 5: 67,097,701 I135T possibly damaging Het
Poln C T 5: 34,129,513 A104T probably benign Het
Prkce A G 17: 86,490,809 D342G probably benign Het
Ptchd3 T A 11: 121,842,938 F885I possibly damaging Het
Rcbtb2 A T 14: 73,177,050 S434C probably damaging Het
Rfc1 A G 5: 65,293,677 V356A probably benign Het
Rln1 A G 19: 29,334,502 F32S probably benign Het
Ryr2 A G 13: 11,662,383 L3194P possibly damaging Het
Sat2 T C 11: 69,622,527 V34A probably damaging Het
Scgb3a2 T C 18: 43,766,719 I24T possibly damaging Het
Slc35e2 T G 4: 155,612,647 V206G probably damaging Het
Slit3 A T 11: 35,661,298 M890L probably benign Het
Sorl1 A G 9: 41,976,407 L2042P probably damaging Het
Ssbp1 T A 6: 40,474,666 V9E probably damaging Het
Tbc1d23 C T 16: 57,178,016 V520M probably damaging Het
Thumpd2 T C 17: 81,054,188 E203G probably benign Het
Tlr11 A G 14: 50,362,678 D707G probably damaging Het
Tlr12 T A 4: 128,616,054 D801V probably damaging Het
Tnrc6b T G 15: 80,879,324 N342K possibly damaging Het
Vmn1r191 A C 13: 22,178,748 F279V probably benign Het
Vmn2r13 A T 5: 109,156,674 C630* probably null Het
Zbtb1 C T 12: 76,385,891 T217I probably damaging Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zzef1 C T 11: 72,895,271 P2090S probably damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
Irrational UTSW 2 155630672 unclassified probably benign
Muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
R7652:Myh7b UTSW 2 155632236 missense probably damaging 0.99
R7703:Myh7b UTSW 2 155620436 missense probably null 1.00
R7711:Myh7b UTSW 2 155620403 missense probably damaging 1.00
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATCGGGCCTTGACACAG -3'
(R):5'- CAACTGCTGCTTGTCTTGTG -3'

Sequencing Primer
(F):5'- GCCTTGACACAGGTGAAGAAC -3'
(R):5'- GTCAGCTTCAAGTCTCCTTCAAG -3'
Posted On2018-05-21