Incidental Mutation 'R6484:Tlr12'
ID517242
Institutional Source Beutler Lab
Gene Symbol Tlr12
Ensembl Gene ENSMUSG00000062545
Gene Nametoll-like receptor 12
SynonymsLOC384059, Tlr11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6484 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location128615443-128618619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128616054 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 801 (D801V)
Ref Sequence ENSEMBL: ENSMUSP00000074381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074829]
Predicted Effect probably damaging
Transcript: ENSMUST00000074829
AA Change: D801V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074381
Gene: ENSMUSG00000062545
AA Change: D801V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
LRR 291 314 1.67e2 SMART
LRR 315 338 9.24e1 SMART
LRR_TYP 341 364 2.79e-4 SMART
LRR 365 388 4.34e-1 SMART
LRR 389 412 1.37e1 SMART
LRR 413 436 1.71e2 SMART
low complexity region 443 459 N/A INTRINSIC
low complexity region 494 502 N/A INTRINSIC
LRR 591 614 5.56e0 SMART
Pfam:TIR 760 905 5.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133382
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation exhibit a greatly increased susceptibility to kidney infection by uropathogenic bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,279,095 V1548A probably damaging Het
3110062M04Rik G A 6: 34,874,616 S101L probably damaging Het
Abce1 A T 8: 79,690,323 M353K probably damaging Het
Adgre4 G A 17: 55,802,036 V348M possibly damaging Het
Alg8 T C 7: 97,382,928 V228A probably benign Het
Btbd8 T C 5: 107,503,585 S115P probably benign Het
Car8 A G 4: 8,189,362 F151L probably benign Het
CN725425 A G 15: 91,260,572 Q546R probably benign Het
Col17a1 C T 19: 47,670,429 V414M possibly damaging Het
Col6a3 C A 1: 90,791,923 probably null Het
Cyp51 G A 5: 4,086,627 T389M probably benign Het
Dazap1 A G 10: 80,277,647 T126A probably benign Het
Dscc1 T A 15: 55,080,290 K395* probably null Het
Dthd1 A G 5: 62,814,332 N166S probably benign Het
Eefsec C G 6: 88,297,788 W398S probably damaging Het
Enpep T A 3: 129,321,481 H214L probably damaging Het
Esf1 T C 2: 140,158,538 I443V probably benign Het
Espl1 T C 15: 102,323,500 V1984A possibly damaging Het
Hip1 A G 5: 135,440,129 S280P probably damaging Het
Il12rb1 C T 8: 70,809,704 probably null Het
Itgax T A 7: 128,133,718 C255S probably benign Het
Kifc5b T C 17: 26,924,772 V506A probably damaging Het
Klf3 A G 5: 64,823,029 E54G probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Mctp1 A G 13: 76,688,625 I104V probably benign Het
Mdga2 T C 12: 66,630,069 E552G possibly damaging Het
Mpc1 A G 17: 8,296,956 E160G possibly damaging Het
Myh10 T A 11: 68,699,467 I76N probably damaging Het
Myh7b A T 2: 155,628,643 I1032F probably benign Het
Olfml2a G A 2: 38,959,768 V499I probably damaging Het
Olfr1311 A T 2: 112,021,419 L145* probably null Het
Olfr1458 A G 19: 13,103,067 V79A probably benign Het
Olfr91 T A 17: 37,093,266 I203F probably benign Het
P2ry12 A G 3: 59,217,333 L307P probably damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Phox2b A G 5: 67,097,701 I135T possibly damaging Het
Poln C T 5: 34,129,513 A104T probably benign Het
Prkce A G 17: 86,490,809 D342G probably benign Het
Ptchd3 T A 11: 121,842,938 F885I possibly damaging Het
Rcbtb2 A T 14: 73,177,050 S434C probably damaging Het
Rfc1 A G 5: 65,293,677 V356A probably benign Het
Rln1 A G 19: 29,334,502 F32S probably benign Het
Ryr2 A G 13: 11,662,383 L3194P possibly damaging Het
Sat2 T C 11: 69,622,527 V34A probably damaging Het
Scgb3a2 T C 18: 43,766,719 I24T possibly damaging Het
Slc35e2 T G 4: 155,612,647 V206G probably damaging Het
Slit3 A T 11: 35,661,298 M890L probably benign Het
Sorl1 A G 9: 41,976,407 L2042P probably damaging Het
Ssbp1 T A 6: 40,474,666 V9E probably damaging Het
Tbc1d23 C T 16: 57,178,016 V520M probably damaging Het
Thumpd2 T C 17: 81,054,188 E203G probably benign Het
Tlr11 A G 14: 50,362,678 D707G probably damaging Het
Tnrc6b T G 15: 80,879,324 N342K possibly damaging Het
Vmn1r191 A C 13: 22,178,748 F279V probably benign Het
Vmn2r13 A T 5: 109,156,674 C630* probably null Het
Zbtb1 C T 12: 76,385,891 T217I probably damaging Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zzef1 C T 11: 72,895,271 P2090S probably damaging Het
Other mutations in Tlr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tlr12 APN 4 128617422 missense probably benign 0.00
IGL00654:Tlr12 APN 4 128617440 missense probably benign 0.27
IGL01290:Tlr12 APN 4 128617837 missense probably damaging 1.00
IGL01406:Tlr12 APN 4 128616339 nonsense probably null
IGL01550:Tlr12 APN 4 128615742 missense probably damaging 1.00
IGL02590:Tlr12 APN 4 128617389 missense probably benign 0.00
IGL02592:Tlr12 APN 4 128617686 missense probably benign 0.02
IGL02635:Tlr12 APN 4 128616816 missense probably damaging 0.98
IGL02714:Tlr12 APN 4 128617713 missense probably damaging 1.00
IGL03104:Tlr12 APN 4 128615892 missense probably benign 0.01
IGL03131:Tlr12 APN 4 128615877 missense probably damaging 1.00
IGL03329:Tlr12 APN 4 128616852 missense possibly damaging 0.84
IGL03354:Tlr12 APN 4 128615937 missense probably damaging 1.00
R0848:Tlr12 UTSW 4 128616291 missense probably benign 0.05
R1536:Tlr12 UTSW 4 128617752 missense possibly damaging 0.95
R1807:Tlr12 UTSW 4 128617436 missense probably benign 0.21
R1989:Tlr12 UTSW 4 128617069 missense probably benign 0.04
R2905:Tlr12 UTSW 4 128616009 missense probably damaging 1.00
R3870:Tlr12 UTSW 4 128616568 missense probably benign 0.00
R4026:Tlr12 UTSW 4 128616508 missense probably benign 0.00
R4296:Tlr12 UTSW 4 128617788 missense probably damaging 1.00
R4398:Tlr12 UTSW 4 128616195 missense probably benign 0.09
R4528:Tlr12 UTSW 4 128618025 missense probably damaging 1.00
R4559:Tlr12 UTSW 4 128615770 missense probably damaging 1.00
R4599:Tlr12 UTSW 4 128617332 missense probably benign 0.06
R4999:Tlr12 UTSW 4 128617680 missense probably benign 0.38
R5054:Tlr12 UTSW 4 128617270 nonsense probably null
R5177:Tlr12 UTSW 4 128618376 missense probably damaging 0.96
R5207:Tlr12 UTSW 4 128616709 nonsense probably null
R5533:Tlr12 UTSW 4 128615863 missense probably damaging 0.99
R6568:Tlr12 UTSW 4 128617992 missense probably benign 0.10
R6821:Tlr12 UTSW 4 128616892 missense possibly damaging 0.95
R7465:Tlr12 UTSW 4 128616170 missense probably damaging 1.00
R7594:Tlr12 UTSW 4 128617680 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGGGTTCCAAGAAGACTAGCAG -3'
(R):5'- CAGGAACTCTTGGATCCCCTAC -3'

Sequencing Primer
(F):5'- GTTCCAAGAAGACTAGCAGCAACAC -3'
(R):5'- ACCTGCAGGCCTTGTTCAG -3'
Posted On2018-05-21