Incidental Mutation 'R6484:Zbtb1'
ID 517268
Institutional Source Beutler Lab
Gene Symbol Zbtb1
Ensembl Gene ENSMUSG00000033454
Gene Name zinc finger and BTB domain containing 1
Synonyms C430003J21Rik
MMRRC Submission 044616-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.762) question?
Stock # R6484 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 76370266-76396950 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 76385891 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 217 (T217I)
Ref Sequence ENSEMBL: ENSMUSP00000041955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042779]
AlphaFold Q91VL9
Predicted Effect probably damaging
Transcript: ENSMUST00000042779
AA Change: T217I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041955
Gene: ENSMUSG00000033454
AA Change: T217I

DomainStartEndE-ValueType
BTB 24 121 1.01e-16 SMART
ZnF_C2H2 216 242 2.17e1 SMART
low complexity region 359 368 N/A INTRINSIC
ZnF_C2H2 421 443 3.38e1 SMART
ZnF_C2H2 534 554 1.4e1 SMART
ZnF_C2H2 578 600 2.02e-1 SMART
ZnF_C2H2 606 628 6.23e-2 SMART
ZnF_C2H2 634 656 1.62e0 SMART
ZnF_C2H2 662 684 1.08e-1 SMART
ZnF_C2H2 686 709 1.36e-2 SMART
Meta Mutation Damage Score 0.2207 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit abnormal thymus, B cell, and T cell differentiation, and reduced numbers of T, B, and NK cells in the spleen. [provided by MGI curators]
Allele List at MGI

www.informatics.jax.org/javawi2/servlet/WIFetch
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,279,095 V1548A probably damaging Het
3110062M04Rik G A 6: 34,874,616 S101L probably damaging Het
Abce1 A T 8: 79,690,323 M353K probably damaging Het
Adgre4 G A 17: 55,802,036 V348M possibly damaging Het
Alg8 T C 7: 97,382,928 V228A probably benign Het
Btbd8 T C 5: 107,503,585 S115P probably benign Het
Car8 A G 4: 8,189,362 F151L probably benign Het
CN725425 A G 15: 91,260,572 Q546R probably benign Het
Col17a1 C T 19: 47,670,429 V414M possibly damaging Het
Col6a3 C A 1: 90,791,923 probably null Het
Cyp51 G A 5: 4,086,627 T389M probably benign Het
Dazap1 A G 10: 80,277,647 T126A probably benign Het
Dscc1 T A 15: 55,080,290 K395* probably null Het
Dthd1 A G 5: 62,814,332 N166S probably benign Het
Eefsec C G 6: 88,297,788 W398S probably damaging Het
Enpep T A 3: 129,321,481 H214L probably damaging Het
Esf1 T C 2: 140,158,538 I443V probably benign Het
Espl1 T C 15: 102,323,500 V1984A possibly damaging Het
Hip1 A G 5: 135,440,129 S280P probably damaging Het
Il12rb1 C T 8: 70,809,704 probably null Het
Itgax T A 7: 128,133,718 C255S probably benign Het
Kifc5b T C 17: 26,924,772 V506A probably damaging Het
Klf3 A G 5: 64,823,029 E54G probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Mctp1 A G 13: 76,688,625 I104V probably benign Het
Mdga2 T C 12: 66,630,069 E552G possibly damaging Het
Mpc1 A G 17: 8,296,956 E160G possibly damaging Het
Myh10 T A 11: 68,699,467 I76N probably damaging Het
Myh7b A T 2: 155,628,643 I1032F probably benign Het
Olfml2a G A 2: 38,959,768 V499I probably damaging Het
Olfr1311 A T 2: 112,021,419 L145* probably null Het
Olfr1458 A G 19: 13,103,067 V79A probably benign Het
Olfr91 T A 17: 37,093,266 I203F probably benign Het
P2ry12 A G 3: 59,217,333 L307P probably damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Phox2b A G 5: 67,097,701 I135T possibly damaging Het
Poln C T 5: 34,129,513 A104T probably benign Het
Prkce A G 17: 86,490,809 D342G probably benign Het
Ptchd3 T A 11: 121,842,938 F885I possibly damaging Het
Rcbtb2 A T 14: 73,177,050 S434C probably damaging Het
Rfc1 A G 5: 65,293,677 V356A probably benign Het
Rln1 A G 19: 29,334,502 F32S probably benign Het
Ryr2 A G 13: 11,662,383 L3194P possibly damaging Het
Sat2 T C 11: 69,622,527 V34A probably damaging Het
Scgb3a2 T C 18: 43,766,719 I24T possibly damaging Het
Slc35e2 T G 4: 155,612,647 V206G probably damaging Het
Slit3 A T 11: 35,661,298 M890L probably benign Het
Sorl1 A G 9: 41,976,407 L2042P probably damaging Het
Ssbp1 T A 6: 40,474,666 V9E probably damaging Het
Tbc1d23 C T 16: 57,178,016 V520M probably damaging Het
Thumpd2 T C 17: 81,054,188 E203G probably benign Het
Tlr11 A G 14: 50,362,678 D707G probably damaging Het
Tlr12 T A 4: 128,616,054 D801V probably damaging Het
Tnrc6b T G 15: 80,879,324 N342K possibly damaging Het
Vmn1r191 A C 13: 22,178,748 F279V probably benign Het
Vmn2r13 A T 5: 109,156,674 C630* probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zzef1 C T 11: 72,895,271 P2090S probably damaging Het
Other mutations in Zbtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01891:Zbtb1 APN 12 76385661 missense probably damaging 1.00
IGL02097:Zbtb1 APN 12 76386597 missense probably damaging 1.00
IGL02328:Zbtb1 APN 12 76386676 missense possibly damaging 0.75
IGL02496:Zbtb1 APN 12 76385395 missense possibly damaging 0.76
IGL03270:Zbtb1 APN 12 76385515 missense possibly damaging 0.59
Limited UTSW 12 76385827 missense probably damaging 0.99
Occasional UTSW 12 76387010 missense probably damaging 1.00
Old_friend UTSW 12 76385891 missense probably damaging 0.96
scant UTSW 12 76385461 missense probably damaging 1.00
R0893:Zbtb1 UTSW 12 76385339 missense probably damaging 1.00
R1317:Zbtb1 UTSW 12 76386799 missense probably benign 0.00
R1525:Zbtb1 UTSW 12 76386432 missense probably benign
R1761:Zbtb1 UTSW 12 76385821 nonsense probably null
R2920:Zbtb1 UTSW 12 76385845 missense possibly damaging 0.83
R5307:Zbtb1 UTSW 12 76386240 missense probably damaging 1.00
R5718:Zbtb1 UTSW 12 76386924 missense probably benign
R5975:Zbtb1 UTSW 12 76386275 missense possibly damaging 0.88
R6493:Zbtb1 UTSW 12 76386473 missense probably benign
R6513:Zbtb1 UTSW 12 76385830 missense possibly damaging 0.55
R6904:Zbtb1 UTSW 12 76386211 nonsense probably null
R6948:Zbtb1 UTSW 12 76385827 missense probably damaging 0.99
R8725:Zbtb1 UTSW 12 76385872 missense probably damaging 1.00
R9202:Zbtb1 UTSW 12 76387010 missense probably damaging 1.00
R9303:Zbtb1 UTSW 12 76385999 missense probably damaging 0.98
R9305:Zbtb1 UTSW 12 76385999 missense probably damaging 0.98
X0028:Zbtb1 UTSW 12 76385299 missense probably damaging 1.00
Z1191:Zbtb1 UTSW 12 76385249 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACGGTGGCTAGAAATGGC -3'
(R):5'- CCGGCTGTGCAGAAAATGTTTTAG -3'

Sequencing Primer
(F):5'- CCAACAGGTGGTGTGCG -3'
(R):5'- GAAGAATCCTTTTCAGCAAGTTCAGC -3'
Posted On 2018-05-21