Mutagenetix > Incidental Mutations

Incidental Mutation 'R6485:Gba2'

517291

Institutional Source

Beutler Lab

Gene Symbol

Gba2

Ensembl Gene

ENSMUSG00000028467

Gene Name

glucosidase beta 2

Synonyms

bile acid

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6485 (G1)

Quality Score

190.009

Status

Not validated

Chromosome

Chromosomal Location

43566928-43578873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 43574118 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 112 (Y112D)

Ref Sequence

ENSEMBL: ENSMUSP00000119589 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030189] [ENSMUST00000030190] [ENSMUST00000107886] [ENSMUST00000117140] [ENSMUST00000130443]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030189
AA Change: Y112D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467
AA Change: Y112D

Domain	Start	End	E-Value	Type
Pfam:GBA2_N	142	446	9.4e-106	PFAM
Pfam:DUF608	512	879	1.3e-153	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000030190

SMART Domains

Protein: ENSMUSP00000030190
Gene: ENSMUSG00000028468

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
Pfam:Rgp1	66	212	3.4e-34	PFAM
Pfam:Rgp1	182	332	1.2e-41	PFAM
low complexity region	333	347	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107886

SMART Domains

Protein: ENSMUSP00000103518
Gene: ENSMUSG00000028468

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
low complexity region	63	77	N/A	INTRINSIC
Pfam:Rgp1	84	164	3.3e-24	PFAM
Pfam:Rgp1	174	331	4.1e-26	PFAM
low complexity region	333	347	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117140

SMART Domains

Protein: ENSMUSP00000113476
Gene: ENSMUSG00000028468

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
low complexity region	63	77	N/A	INTRINSIC
Pfam:Rgp1	84	165	2.9e-24	PFAM
Pfam:Rgp1	173	331	3.5e-26	PFAM
low complexity region	333	347	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128403

Predicted Effect

probably damaging
Transcript: ENSMUST00000130443
AA Change: Y112D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467
AA Change: Y112D

Domain	Start	End	E-Value	Type
Pfam:GBA2_N	142	180	5.6e-13	PFAM
Pfam:GBA2_N	178	227	1.5e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131178

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139606

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144968

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148426

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152251

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of glucosylceramides in multiple tissues, and show impaired male fertility associated with globozoospermia, oligozoospermia, reduced sperm motility, and male germ cell apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	C	A	7: 120,427,167	Y117*	probably null	Het
Acot5	A	T	12: 84,075,484	R281W	probably damaging	Het
Adamts20	T	C	15: 94,343,971	T719A	probably benign	Het
Arhgap33	T	C	7: 30,524,004	T867A	probably benign	Het
Bcl2a1c	T	C	9: 114,330,210	Y19H	probably benign	Het
Bod1l	A	G	5: 41,817,116	I2285T	possibly damaging	Het
Cacna2d1	A	G	5: 16,354,657	Y755C	probably damaging	Het
Cdc27	T	C	11: 104,505,648	T816A	probably benign	Het
Clasrp	C	A	7: 19,586,369		probably benign	Het
Col6a4	A	G	9: 106,076,870		probably null	Het
Cpd	T	C	11: 76,808,707		probably null	Het
Crispld2	A	G	8: 120,029,309	D339G	probably damaging	Het
Dst	A	G	1: 34,294,529	D7046G	probably damaging	Het
Erbin	G	T	13: 103,868,113	Q136K	probably damaging	Het
Exph5	G	A	9: 53,376,691	E1691K	possibly damaging	Het
Fads6	A	G	11: 115,285,438	F187S	probably benign	Het
Foxg1	A	T	12: 49,385,080	I199F	probably damaging	Het
Garem1	T	C	18: 21,129,837	D640G	probably benign	Het
Gcfc2	T	C	6: 81,939,547	I323T	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gria4	T	A	9: 4,464,249	Y571F	probably damaging	Het
Large2	T	C	2: 92,366,028	T485A	probably benign	Het
Lonrf1	A	G	8: 36,229,134		probably null	Het
Mrgprb5	T	C	7: 48,168,777	N70S	probably damaging	Het
Muc2	T	A	7: 141,746,736		probably benign	Het
Nol4	T	C	18: 22,770,793	D375G	probably damaging	Het
Olfr1359	A	G	13: 21,703,430	Q143R	probably benign	Het
Pcnt	G	T	10: 76,389,330	S1780*	probably null	Het
Pdgfra	A	T	5: 75,175,074		probably null	Het
Pgd	A	T	4: 149,156,419		probably null	Het
Pla2g6	T	C	15: 79,307,372	I279V	probably benign	Het
Ptpn21	A	T	12: 98,698,872	C297*	probably null	Het
Ripply1	TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT	TTCCTCCTCCTCCTCCTCCTCCTCCTCCT	X: 139,779,850		probably benign	Het
Rtcb	T	C	10: 85,957,644	I22V	probably benign	Het
Slc25a30	G	T	14: 75,775,007	A67E	probably damaging	Het
Stk11ip	T	C	1: 75,529,968	V605A	possibly damaging	Het
Ush1c	A	T	7: 46,209,110	S585T	probably benign	Het
Vps13a	T	C	19: 16,680,050	D1785G	probably damaging	Het
Zic5	T	A	14: 122,459,640	Y521F	unknown	Het

Other mutations in Gba2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Gba2	APN	4	43568477	missense	probably damaging	1.00
IGL01577:Gba2	APN	4	43573753	nonsense	probably null
IGL02066:Gba2	APN	4	43570175	missense	probably benign	0.18
IGL02126:Gba2	APN	4	43567918	critical splice acceptor site	probably null
IGL02243:Gba2	APN	4	43568719	missense	probably benign	0.13
IGL02474:Gba2	APN	4	43568538	missense	possibly damaging	0.69
IGL02567:Gba2	APN	4	43567281	missense	probably benign
IGL02628:Gba2	APN	4	43568919	missense	probably benign	0.01
IGL02706:Gba2	APN	4	43567257	missense	probably benign	0.01
IGL02795:Gba2	APN	4	43578331	missense	probably damaging	1.00
R0389:Gba2	UTSW	4	43570832	missense	probably damaging	1.00
R0555:Gba2	UTSW	4	43569927	missense	probably damaging	1.00
R0650:Gba2	UTSW	4	43570424	splice site	probably null
R1603:Gba2	UTSW	4	43567823	missense	probably damaging	1.00
R1628:Gba2	UTSW	4	43570118	missense	probably benign	0.00
R1664:Gba2	UTSW	4	43578080	missense	probably benign	0.01
R1686:Gba2	UTSW	4	43573869	splice site	probably benign
R1730:Gba2	UTSW	4	43578242	missense	probably benign	0.01
R2036:Gba2	UTSW	4	43568118	unclassified	probably benign
R2061:Gba2	UTSW	4	43574029	nonsense	probably null
R2259:Gba2	UTSW	4	43570107	missense	probably benign
R2847:Gba2	UTSW	4	43568000	splice site	probably null
R3026:Gba2	UTSW	4	43578308	missense	possibly damaging	0.95
R3617:Gba2	UTSW	4	43573803	missense	probably damaging	1.00
R4225:Gba2	UTSW	4	43569464	unclassified	probably benign
R4346:Gba2	UTSW	4	43571337	missense	probably benign	0.04
R4601:Gba2	UTSW	4	43573810	missense	probably damaging	1.00
R4611:Gba2	UTSW	4	43568092	missense	probably damaging	1.00
R4664:Gba2	UTSW	4	43568619	unclassified	probably benign
R4784:Gba2	UTSW	4	43568315	missense	probably damaging	1.00
R4785:Gba2	UTSW	4	43568315	missense	probably damaging	1.00
R5079:Gba2	UTSW	4	43568640	unclassified	probably benign
R5327:Gba2	UTSW	4	43574063	missense	probably damaging	1.00
R5746:Gba2	UTSW	4	43568465	splice site	probably null
R6052:Gba2	UTSW	4	43568330	missense	probably damaging	1.00
R7073:Gba2	UTSW	4	43573753	missense	probably damaging	1.00
R7112:Gba2	UTSW	4	43568453	missense	probably benign	0.01
R7472:Gba2	UTSW	4	43568967	missense	probably benign	0.44
R8220:Gba2	UTSW	4	43568510	missense	probably damaging	1.00
R8315:Gba2	UTSW	4	43569937	frame shift	probably null
R8476:Gba2	UTSW	4	43569944	missense	probably damaging	0.98
R8477:Gba2	UTSW	4	43569944	missense	probably damaging	0.98
RF007:Gba2	UTSW	4	43569894	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCATGCATAAACTAGGAGCC -3'
(R):5'- GATACTAGTGATGGGTCGGC -3'

Sequencing Primer
(F):5'- GCATAAACTAGGAGCCTTTTTGCCTG -3'
(R):5'- GCTGGCCTCAAACTTGTAATG -3'

Posted On

2018-05-21