Incidental Mutation 'R6485:Cacna2d1'
ID517292
Institutional Source Beutler Lab
Gene Symbol Cacna2d1
Ensembl Gene ENSMUSG00000040118
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 1
SynonymsCa(v)alpha2delta1, Cacna2, Cchl2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.520) question?
Stock #R6485 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location15934691-16374511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16354657 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 755 (Y755C)
Ref Sequence ENSEMBL: ENSMUSP00000142881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039370] [ENSMUST00000078272] [ENSMUST00000101581] [ENSMUST00000115281] [ENSMUST00000167946] [ENSMUST00000180204] [ENSMUST00000199704]
Predicted Effect probably damaging
Transcript: ENSMUST00000039370
AA Change: Y779C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049457
Gene: ENSMUSG00000040118
AA Change: Y779C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.3e-42 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 536 1e-31 PFAM
Pfam:VGCC_alpha2 562 655 1e-46 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078272
AA Change: Y760C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077391
Gene: ENSMUSG00000040118
AA Change: Y760C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 634 3.3e-53 PFAM
low complexity region 656 667 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101581
AA Change: Y767C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099117
Gene: ENSMUSG00000040118
AA Change: Y767C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 636 1.2e-59 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115281
AA Change: Y762C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110936
Gene: ENSMUSG00000040118
AA Change: Y762C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167946
AA Change: Y767C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131507
Gene: ENSMUSG00000040118
AA Change: Y767C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 3.8e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 2.6e-30 PFAM
Pfam:VGCC_alpha2 543 636 5.5e-56 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180204
AA Change: Y762C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136260
Gene: ENSMUSG00000040118
AA Change: Y762C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199704
AA Change: Y755C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142881
Gene: ENSMUSG00000040118
AA Change: Y755C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 6.3e-30 PFAM
Pfam:VGCC_alpha2 538 629 3.3e-53 PFAM
low complexity region 651 662 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a regulatory component of the voltage-dependent calcium channel complex. The product of this gene is a proprotein that is proteolytically processed into alpha-2 and delta subunits, which are linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice with a point mutation allele exhibit abnormal CNS synaptic transmission and decreased response to pregabalin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Cacna2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cacna2d1 APN 5 16212944 missense probably damaging 1.00
IGL00470:Cacna2d1 APN 5 16246656 splice site probably benign
IGL00495:Cacna2d1 APN 5 16370609 missense probably benign 0.05
IGL00538:Cacna2d1 APN 5 16246785 nonsense probably null
IGL00990:Cacna2d1 APN 5 15935069 missense probably benign 0.23
IGL01079:Cacna2d1 APN 5 16370648 missense probably benign 0.03
IGL01344:Cacna2d1 APN 5 16370631 missense probably benign 0.26
IGL01597:Cacna2d1 APN 5 16326392 splice site probably benign
IGL01645:Cacna2d1 APN 5 16012391 splice site probably null
IGL01959:Cacna2d1 APN 5 16212897 missense probably benign 0.00
IGL02397:Cacna2d1 APN 5 16320164 splice site probably benign
IGL03152:Cacna2d1 APN 5 16322568 missense probably benign 0.00
IGL03216:Cacna2d1 APN 5 16353842 missense probably damaging 0.98
IGL03374:Cacna2d1 APN 5 16356823 missense probably damaging 0.99
PIT4283001:Cacna2d1 UTSW 5 16302294 missense probably benign 0.31
PIT4585001:Cacna2d1 UTSW 5 16326344 missense probably damaging 1.00
R0158:Cacna2d1 UTSW 5 16361817 splice site probably benign
R0457:Cacna2d1 UTSW 5 16267416 missense probably damaging 1.00
R0477:Cacna2d1 UTSW 5 16194798 critical splice donor site probably null
R0483:Cacna2d1 UTSW 5 16359027 missense probably damaging 0.98
R0532:Cacna2d1 UTSW 5 16362273 missense probably benign 0.13
R0552:Cacna2d1 UTSW 5 16328043 missense probably damaging 1.00
R0924:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R0930:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R1144:Cacna2d1 UTSW 5 16322597 critical splice donor site probably null
R1164:Cacna2d1 UTSW 5 16361876 critical splice donor site probably null
R1398:Cacna2d1 UTSW 5 16357766 missense possibly damaging 0.47
R1440:Cacna2d1 UTSW 5 16355495 missense probably damaging 1.00
R1543:Cacna2d1 UTSW 5 16266718 missense possibly damaging 0.62
R1573:Cacna2d1 UTSW 5 16370627 missense probably damaging 1.00
R1633:Cacna2d1 UTSW 5 16320116 missense probably damaging 1.00
R1673:Cacna2d1 UTSW 5 16299990 missense probably damaging 1.00
R1750:Cacna2d1 UTSW 5 16264288 missense probably benign 0.01
R1753:Cacna2d1 UTSW 5 16302354 missense possibly damaging 0.95
R1966:Cacna2d1 UTSW 5 16333785 nonsense probably null
R2163:Cacna2d1 UTSW 5 16362319 missense probably damaging 1.00
R2258:Cacna2d1 UTSW 5 16357289 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R4303:Cacna2d1 UTSW 5 16302248 splice site probably null
R4804:Cacna2d1 UTSW 5 16359208 missense probably damaging 0.97
R5032:Cacna2d1 UTSW 5 16359070 missense probably damaging 1.00
R5080:Cacna2d1 UTSW 5 16362396 critical splice donor site probably null
R5466:Cacna2d1 UTSW 5 16246714 missense probably damaging 1.00
R5469:Cacna2d1 UTSW 5 16352678 missense probably damaging 0.99
R5564:Cacna2d1 UTSW 5 16312519 missense probably damaging 1.00
R5655:Cacna2d1 UTSW 5 16302335 missense probably damaging 1.00
R5688:Cacna2d1 UTSW 5 16358952 missense probably damaging 0.99
R5729:Cacna2d1 UTSW 5 15935039 nonsense probably null
R6005:Cacna2d1 UTSW 5 16361821 missense probably damaging 1.00
R6343:Cacna2d1 UTSW 5 16322564 missense probably benign 0.09
R6486:Cacna2d1 UTSW 5 16319450 splice site probably null
R6625:Cacna2d1 UTSW 5 16362393 missense probably null 1.00
R6700:Cacna2d1 UTSW 5 16365460 missense probably damaging 1.00
R6706:Cacna2d1 UTSW 5 16326340 missense probably damaging 1.00
R6711:Cacna2d1 UTSW 5 16300041 missense probably damaging 1.00
R7025:Cacna2d1 UTSW 5 16352668 nonsense probably null
R7035:Cacna2d1 UTSW 5 16246672 missense probably damaging 1.00
R7086:Cacna2d1 UTSW 5 16349416 missense probably damaging 1.00
R7110:Cacna2d1 UTSW 5 16357784 missense probably damaging 0.99
R7268:Cacna2d1 UTSW 5 16370588 missense probably damaging 0.99
R7310:Cacna2d1 UTSW 5 16314916 missense probably damaging 1.00
R7471:Cacna2d1 UTSW 5 15934975 start gained probably benign
R7608:Cacna2d1 UTSW 5 16359024 missense probably damaging 1.00
R7712:Cacna2d1 UTSW 5 16362349 missense probably damaging 0.98
R8014:Cacna2d1 UTSW 5 16342691 missense possibly damaging 0.55
R8161:Cacna2d1 UTSW 5 16314937 missense probably damaging 1.00
RF024:Cacna2d1 UTSW 5 16025776 missense possibly damaging 0.80
Z1088:Cacna2d1 UTSW 5 16194763 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAGACATGTCTGTAGAGCTGTATG -3'
(R):5'- TCTGCATTGCTAGATGACCTTTTG -3'

Sequencing Primer
(F):5'- CTGTAGAGCTGTATGTTCACAAAAGG -3'
(R):5'- CTAGATGACCTTTTGCTGTGC -3'
Posted On2018-05-21