Incidental Mutation 'R6485:Gcfc2'
ID517294
Institutional Source Beutler Lab
Gene Symbol Gcfc2
Ensembl Gene ENSMUSG00000035125
Gene NameGC-rich sequence DNA binding factor 2
SynonymsAW146020
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock #R6485 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location81923669-81959915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81939547 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 323 (I323T)
Ref Sequence ENSEMBL: ENSMUSP00000035644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043195] [ENSMUST00000152996]
Predicted Effect probably damaging
Transcript: ENSMUST00000043195
AA Change: I323T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125
AA Change: I323T

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
coiled coil region 255 308 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
Pfam:GCFC 456 672 3e-34 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132301
Predicted Effect probably benign
Transcript: ENSMUST00000152996
SMART Domains Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Gcfc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Gcfc2 APN 6 81936015 missense probably damaging 0.99
IGL00473:Gcfc2 APN 6 81944374 missense probably damaging 1.00
IGL00497:Gcfc2 APN 6 81957970 missense probably benign 0.08
IGL02135:Gcfc2 APN 6 81941400 missense probably damaging 1.00
R0138:Gcfc2 UTSW 6 81949954 missense probably damaging 1.00
R0208:Gcfc2 UTSW 6 81943463 missense probably null 0.91
R0467:Gcfc2 UTSW 6 81923882 missense possibly damaging 0.56
R1105:Gcfc2 UTSW 6 81939453 missense probably damaging 1.00
R1521:Gcfc2 UTSW 6 81923812 missense probably benign 0.14
R1602:Gcfc2 UTSW 6 81944420 missense probably damaging 1.00
R1846:Gcfc2 UTSW 6 81956892 missense probably damaging 0.99
R2091:Gcfc2 UTSW 6 81943479 missense probably damaging 1.00
R2110:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2111:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2112:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2892:Gcfc2 UTSW 6 81956913 missense possibly damaging 0.87
R3792:Gcfc2 UTSW 6 81930767 missense probably benign 0.00
R4284:Gcfc2 UTSW 6 81941391 missense probably damaging 1.00
R4304:Gcfc2 UTSW 6 81943007 missense probably damaging 1.00
R4691:Gcfc2 UTSW 6 81941427 nonsense probably null
R5046:Gcfc2 UTSW 6 81948335 missense probably benign 0.12
R5233:Gcfc2 UTSW 6 81953290 missense probably damaging 1.00
R5307:Gcfc2 UTSW 6 81944386 missense probably damaging 0.97
R5308:Gcfc2 UTSW 6 81943543 critical splice donor site probably null
R5929:Gcfc2 UTSW 6 81946599 missense probably damaging 1.00
R6339:Gcfc2 UTSW 6 81946496 missense probably damaging 1.00
R6931:Gcfc2 UTSW 6 81942985 missense probably benign 0.36
R6948:Gcfc2 UTSW 6 81933753 missense probably benign 0.01
R7392:Gcfc2 UTSW 6 81943012 critical splice donor site probably null
R7423:Gcfc2 UTSW 6 81946560 missense probably damaging 1.00
R7509:Gcfc2 UTSW 6 81953275 missense probably damaging 1.00
R7713:Gcfc2 UTSW 6 81941390 missense probably damaging 1.00
R8089:Gcfc2 UTSW 6 81925790 missense probably damaging 1.00
R8249:Gcfc2 UTSW 6 81956951 missense probably benign 0.02
R8366:Gcfc2 UTSW 6 81923801 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTGGTCTCTCTAGCTTCACAAGTC -3'
(R):5'- GGCCCATGTCTAACAGCAAG -3'

Sequencing Primer
(F):5'- GGTTTCTACAGTAATCACTATGTCTG -3'
(R):5'- TTGCACAGTAAGAACCTGCTG -3'
Posted On2018-05-21