Incidental Mutation 'R6485:Mrgprb5'
ID517298
Institutional Source Beutler Lab
Gene Symbol Mrgprb5
Ensembl Gene ENSMUSG00000070551
Gene NameMAS-related GPR, member B5
SynonymsMrgB5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6485 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location48167983-48169019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48168777 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 70 (N70S)
Ref Sequence ENSEMBL: ENSMUSP00000091953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094389]
Predicted Effect probably damaging
Transcript: ENSMUST00000094389
AA Change: N70S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091953
Gene: ENSMUSG00000070551
AA Change: N70S

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 38 217 1.4e-8 PFAM
Pfam:7tm_1 47 210 1.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Mrgprb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mrgprb5 APN 7 48168384 missense probably damaging 1.00
IGL01662:Mrgprb5 APN 7 48168424 missense probably benign 0.02
IGL01752:Mrgprb5 APN 7 48168667 missense probably benign 0.22
IGL02117:Mrgprb5 APN 7 48168994 utr 5 prime probably benign
IGL02866:Mrgprb5 APN 7 48168166 missense probably damaging 0.99
IGL03382:Mrgprb5 APN 7 48168694 missense probably benign 0.01
R0545:Mrgprb5 UTSW 7 48168885 missense probably benign 0.08
R1389:Mrgprb5 UTSW 7 48168330 missense probably damaging 1.00
R1939:Mrgprb5 UTSW 7 48168938 missense probably benign 0.00
R2277:Mrgprb5 UTSW 7 48168831 missense probably damaging 1.00
R2367:Mrgprb5 UTSW 7 48168599 nonsense probably null
R2912:Mrgprb5 UTSW 7 48168067 missense probably benign
R2968:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2969:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2970:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R3499:Mrgprb5 UTSW 7 48168913 missense probably benign 0.04
R3828:Mrgprb5 UTSW 7 48168091 missense probably benign 0.01
R4590:Mrgprb5 UTSW 7 48168061 missense probably benign 0.16
R4719:Mrgprb5 UTSW 7 48168778 missense probably damaging 1.00
R5263:Mrgprb5 UTSW 7 48168189 missense probably damaging 0.99
R5264:Mrgprb5 UTSW 7 48168048 missense probably benign 0.10
R5644:Mrgprb5 UTSW 7 48168207 missense probably benign 0.00
R6713:Mrgprb5 UTSW 7 48168789 missense probably damaging 0.98
R7112:Mrgprb5 UTSW 7 48168907 missense probably benign
R7176:Mrgprb5 UTSW 7 48168311 missense possibly damaging 0.68
R7446:Mrgprb5 UTSW 7 48168504 missense possibly damaging 0.65
R7640:Mrgprb5 UTSW 7 48168259 missense probably benign 0.00
R7831:Mrgprb5 UTSW 7 48168249 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GATACCAGATGGGCCACATAAC -3'
(R):5'- AACATGGGTCTAACCACTCCAG -3'

Sequencing Primer
(F):5'- CAGATAGAGAGCGCTCAACACTG -3'
(R):5'- GTCTAACCACTCCAGCCTGG -3'
Posted On2018-05-21