Incidental Mutation 'R6485:Acot5'
ID517313
Institutional Source Beutler Lab
Gene Symbol Acot5
Ensembl Gene ENSMUSG00000042540
Gene Nameacyl-CoA thioesterase 5
SynonymsPTE-Ic
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6485 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location84069325-84076020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84075484 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 281 (R281W)
Ref Sequence ENSEMBL: ENSMUSP00000072322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046422] [ENSMUST00000072505]
Predicted Effect probably damaging
Transcript: ENSMUST00000046422
AA Change: R281W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042019
Gene: ENSMUSG00000042540
AA Change: R281W

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 16 141 7.4e-44 PFAM
low complexity region 147 161 N/A INTRINSIC
Pfam:BAAT_C 203 412 3.5e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072505
AA Change: R281W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072322
Gene: ENSMUSG00000042540
AA Change: R281W

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 15 142 1.6e-42 PFAM
low complexity region 147 161 N/A INTRINSIC
Pfam:BAAT_C 203 313 1.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Acot5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Acot5 APN 12 84075488 missense probably benign 0.01
IGL01978:Acot5 APN 12 84075398 missense possibly damaging 0.90
IGL03175:Acot5 APN 12 84075329 missense probably damaging 1.00
R0840:Acot5 UTSW 12 84075840 nonsense probably null
R1720:Acot5 UTSW 12 84075881 missense probably benign
R1735:Acot5 UTSW 12 84075487 missense probably benign 0.38
R2258:Acot5 UTSW 12 84075869 missense possibly damaging 0.94
R2260:Acot5 UTSW 12 84075869 missense possibly damaging 0.94
R2307:Acot5 UTSW 12 84075601 missense possibly damaging 0.90
R2655:Acot5 UTSW 12 84075876 missense probably benign 0.00
R5291:Acot5 UTSW 12 84073519 missense probably benign 0.04
R5302:Acot5 UTSW 12 84073441 missense probably damaging 0.99
R5545:Acot5 UTSW 12 84069606 missense possibly damaging 0.69
R5999:Acot5 UTSW 12 84075554 missense probably benign 0.00
R7554:Acot5 UTSW 12 84073480 missense probably damaging 1.00
R7663:Acot5 UTSW 12 84069581 missense probably damaging 0.97
R7833:Acot5 UTSW 12 84075827 missense probably damaging 1.00
Z1177:Acot5 UTSW 12 84069894 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TCTTAGGTCAAGGGTCCAGG -3'
(R):5'- GACAATCTGGGGCTTCTCCTTC -3'

Sequencing Primer
(F):5'- CTTAGGTCAAGGGTCCAGGAGTTG -3'
(R):5'- CCTGCAGGCGTTTGGAG -3'
Posted On2018-05-21