Incidental Mutation 'R6485:Ptpn21'
ID517314
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R6485 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 98698872 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 297 (C297*)
Ref Sequence ENSEMBL: ENSMUSP00000152639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]
Predicted Effect probably null
Transcript: ENSMUST00000085116
AA Change: C297*
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: C297*

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170188
AA Change: C297*
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: C297*

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably null
Transcript: ENSMUST00000221148
AA Change: C297*
Predicted Effect probably null
Transcript: ENSMUST00000221535
AA Change: C297*
Predicted Effect probably null
Transcript: ENSMUST00000221932
AA Change: C297*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4197:Ptpn21 UTSW 12 98680138 missense probably damaging 1.00
R4283:Ptpn21 UTSW 12 98733475 missense probably damaging 0.99
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4703:Ptpn21 UTSW 12 98679392 missense probably benign 0.00
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4829:Ptpn21 UTSW 12 98689296 missense probably damaging 1.00
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5395:Ptpn21 UTSW 12 98715117 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5741:Ptpn21 UTSW 12 98679289 missense probably damaging 1.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6005:Ptpn21 UTSW 12 98678552 makesense probably null
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98680116 missense probably benign 0.24
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7122:Ptpn21 UTSW 12 98688912 missense probably damaging 0.99
R7232:Ptpn21 UTSW 12 98688737 missense probably benign 0.17
R7289:Ptpn21 UTSW 12 98704191 missense probably benign 0.35
R7327:Ptpn21 UTSW 12 98680101 missense probably damaging 1.00
R7474:Ptpn21 UTSW 12 98737363 critical splice donor site probably null
R7748:Ptpn21 UTSW 12 98688772 missense probably benign 0.01
R7816:Ptpn21 UTSW 12 98682532 missense probably damaging 1.00
R7867:Ptpn21 UTSW 12 98705176 missense probably damaging 1.00
R7878:Ptpn21 UTSW 12 98715128 missense probably damaging 1.00
R7911:Ptpn21 UTSW 12 98688842 missense probably damaging 0.99
R7950:Ptpn21 UTSW 12 98705176 missense probably damaging 1.00
R7961:Ptpn21 UTSW 12 98715128 missense probably damaging 1.00
R7992:Ptpn21 UTSW 12 98688842 missense probably damaging 0.99
Z1177:Ptpn21 UTSW 12 98688458 missense not run
Predicted Primers PCR Primer
(F):5'- CCTTCAAGGATGAGGAGGTG -3'
(R):5'- TCACTGTGGGGATGAGAGAGTC -3'

Sequencing Primer
(F):5'- CTCACTCAGTGGGGAGTATGACTC -3'
(R):5'- CACTGTGGGGATGAGGGAGTC -3'
Posted On2018-05-21