Incidental Mutation 'R6485:Olfr1359'
ID517315
Institutional Source Beutler Lab
Gene Symbol Olfr1359
Ensembl Gene ENSMUSG00000108674
Gene Nameolfactory receptor 1359
SynonymsMOR256-60, MOR256-35, GA_x6K02T2QHY8-11534186-11533245
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6485 (G1)
Quality Score136.008
Status Not validated
Chromosome13
Chromosomal Location21698111-21706833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21703430 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 143 (Q143R)
Ref Sequence ENSEMBL: ENSMUSP00000150106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077843] [ENSMUST00000214435]
Predicted Effect probably benign
Transcript: ENSMUST00000077843
AA Change: Q143R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077010
Gene: ENSMUSG00000108674
AA Change: Q143R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-55 PFAM
Pfam:7tm_1 41 290 1.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214006
Predicted Effect probably benign
Transcript: ENSMUST00000214435
AA Change: Q143R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Olfr1359
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Olfr1359 APN 13 21703073 missense probably benign 0.21
R1601:Olfr1359 UTSW 13 21703226 missense probably damaging 1.00
R1743:Olfr1359 UTSW 13 21703450 missense probably benign 0.00
R1944:Olfr1359 UTSW 13 21703117 missense possibly damaging 0.95
R4084:Olfr1359 UTSW 13 21703068 nonsense probably null
R4084:Olfr1359 UTSW 13 21703069 missense probably damaging 1.00
R5677:Olfr1359 UTSW 13 21703223 missense probably benign 0.03
R6981:Olfr1359 UTSW 13 21703073 missense probably benign 0.21
R7028:Olfr1359 UTSW 13 21703270 missense possibly damaging 0.95
R7221:Olfr1359 UTSW 13 21703102 missense probably damaging 1.00
R7799:Olfr1359 UTSW 13 21703199 missense probably damaging 1.00
R8400:Olfr1359 UTSW 13 21703915 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCTGTGCTACACCACAAG -3'
(R):5'- ACTGATGAAGAACAGCTCTGCTTC -3'

Sequencing Primer
(F):5'- GATGCTCATCAACATCTGCAG -3'
(R):5'- CATTAGCTGTCGTATCCACACAGG -3'
Posted On2018-05-21