Incidental Mutation 'R6485:Slc25a30'
ID517317
Institutional Source Beutler Lab
Gene Symbol Slc25a30
Ensembl Gene ENSMUSG00000022003
Gene Namesolute carrier family 25, member 30
Synonyms4933433D23Rik, KMCP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6485 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location75760117-75787037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75775007 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 67 (A67E)
Ref Sequence ENSEMBL: ENSMUSP00000022580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022580] [ENSMUST00000227894]
Predicted Effect probably damaging
Transcript: ENSMUST00000022580
AA Change: A67E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022580
Gene: ENSMUSG00000022003
AA Change: A67E

DomainStartEndE-ValueType
Pfam:Mito_carr 2 100 1.2e-22 PFAM
Pfam:Mito_carr 102 194 3.2e-22 PFAM
Pfam:Mito_carr 197 290 7.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227621
Predicted Effect probably damaging
Transcript: ENSMUST00000227894
AA Change: A16E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228528
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Although the outer mitochondrial membrane is permeable to many small metabolites, transport of solutes across the inner mitochondrial membrane is achieved by members of the mitochondrial carrier protein family, such as SLC25A30 (Haguenauer et al., 2005 [PubMed 15809292]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Slc25a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Slc25a30 APN 14 75766925 missense possibly damaging 0.90
IGL00922:Slc25a30 APN 14 75769598 missense probably damaging 1.00
IGL01310:Slc25a30 APN 14 75769597 missense probably damaging 1.00
IGL02135:Slc25a30 APN 14 75766995 missense probably benign 0.00
IGL02573:Slc25a30 APN 14 75769668 splice site probably benign
R0044:Slc25a30 UTSW 14 75769649 missense probably benign 0.37
R0330:Slc25a30 UTSW 14 75762672 nonsense probably null
R1743:Slc25a30 UTSW 14 75775083 missense probably benign 0.01
R1744:Slc25a30 UTSW 14 75763330 missense probably damaging 1.00
R1950:Slc25a30 UTSW 14 75769567 missense possibly damaging 0.55
R2122:Slc25a30 UTSW 14 75770218 missense possibly damaging 0.90
R2880:Slc25a30 UTSW 14 75770211 missense probably benign 0.05
R4791:Slc25a30 UTSW 14 75763366 missense probably benign 0.00
R5158:Slc25a30 UTSW 14 75771516 missense probably damaging 1.00
R5198:Slc25a30 UTSW 14 75769616 missense probably benign 0.03
R5505:Slc25a30 UTSW 14 75763349 missense probably damaging 1.00
R8393:Slc25a30 UTSW 14 75775011 missense probably benign 0.04
X0027:Slc25a30 UTSW 14 75766973 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGGTCAAGTCTTTTCTTGCTCACTT -3'
(R):5'- GGCTATTTCTTATTTCAGGGAGATTCT -3'

Sequencing Primer
(F):5'- CACTTTCCCATCAGTAGCTTAATG -3'
(R):5'- AACTTCCGAGAGATCAGG -3'
Posted On2018-05-21