Incidental Mutation 'R6485:Zic5'
ID517318
Institutional Source Beutler Lab
Gene Symbol Zic5
Ensembl Gene ENSMUSG00000041703
Gene Namezinc finger protein of the cerebellum 5
Synonymsodd-paired related, 1700049L20Rik, Opr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6485 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location122456795-122465677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122459640 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 521 (Y521F)
Ref Sequence ENSEMBL: ENSMUSP00000035754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039118]
Predicted Effect unknown
Transcript: ENSMUST00000039118
AA Change: Y521F
SMART Domains Protein: ENSMUSP00000035754
Gene: ENSMUSG00000041703
AA Change: Y521F

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 116 154 N/A INTRINSIC
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
ZnF_C2H2 390 408 2.2e2 SMART
ZnF_C2H2 417 444 2.14e0 SMART
ZnF_C2H2 450 474 8.02e-5 SMART
ZnF_C2H2 480 504 2.53e-2 SMART
ZnF_C2H2 510 534 7.49e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143084
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 2, a related family member on chromosome 13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality and reduced life spans with exencephaly, abnormal cerebral cortex and diencephalon morphology, abnormal gait and posture, and impaired growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Other mutations in Zic5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Zic5 APN 14 122459512 missense unknown
Ezekiel UTSW 14 122465154 missense unknown
R0227:Zic5 UTSW 14 122459661 missense unknown
R0646:Zic5 UTSW 14 122463939 missense unknown
R1327:Zic5 UTSW 14 122459779 splice site probably benign
R1387:Zic5 UTSW 14 122459485 missense unknown
R1665:Zic5 UTSW 14 122459527 missense unknown
R2020:Zic5 UTSW 14 122464830 missense unknown
R2571:Zic5 UTSW 14 122459478 missense unknown
R4241:Zic5 UTSW 14 122464663 missense probably benign 0.03
R4610:Zic5 UTSW 14 122464800 missense probably damaging 0.98
R4706:Zic5 UTSW 14 122459557 missense unknown
R5496:Zic5 UTSW 14 122459343 missense unknown
R6178:Zic5 UTSW 14 122459336 missense unknown
R6189:Zic5 UTSW 14 122464974 missense unknown
R6332:Zic5 UTSW 14 122459749 missense unknown
R6564:Zic5 UTSW 14 122459421 missense unknown
R6677:Zic5 UTSW 14 122465154 missense unknown
R6877:Zic5 UTSW 14 122459688 missense unknown
R6977:Zic5 UTSW 14 122459548 missense unknown
R6977:Zic5 UTSW 14 122459555 small deletion probably benign
R6978:Zic5 UTSW 14 122459548 missense unknown
R6978:Zic5 UTSW 14 122459555 small deletion probably benign
R6996:Zic5 UTSW 14 122464668 missense probably benign 0.02
R7713:Zic5 UTSW 14 122464113 missense unknown
R8492:Zic5 UTSW 14 122465062 missense unknown
Predicted Primers PCR Primer
(F):5'- CACTGGCCTGGCAAACATAC -3'
(R):5'- ATTGCTTCAAATGAGAGGTCTCTGG -3'

Sequencing Primer
(F):5'- ACATACCACTCATTGAGGTTGGTCAC -3'
(R):5'- TTCAAATGAGAGGTCTCTGGGAAGC -3'
Posted On2018-05-21