Incidental Mutation 'R6485:Nol4'
ID517322
Institutional Source Beutler Lab
Gene Symbol Nol4
Ensembl Gene ENSMUSG00000041923
Gene Namenucleolar protein 4
Synonyms4930568N03Rik, 1700013J13Rik, LOC383304
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R6485 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location22693181-23041653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22770793 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 375 (D375G)
Ref Sequence ENSEMBL: ENSMUSP00000130950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081423] [ENSMUST00000097651] [ENSMUST00000164186] [ENSMUST00000164893]
Predicted Effect unknown
Transcript: ENSMUST00000069215
AA Change: D156G
SMART Domains Protein: ENSMUSP00000064166
Gene: ENSMUSG00000041923
AA Change: D156G

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 368 378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081423
AA Change: D302G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080150
Gene: ENSMUSG00000041923
AA Change: D302G

DomainStartEndE-ValueType
low complexity region 139 155 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
low complexity region 487 506 N/A INTRINSIC
low complexity region 513 523 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000092015
AA Change: D156G
SMART Domains Protein: ENSMUSP00000089642
Gene: ENSMUSG00000041923
AA Change: D156G

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 278 297 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097651
AA Change: D375G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095256
Gene: ENSMUSG00000041923
AA Change: D375G

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164186
AA Change: D375G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130950
Gene: ENSMUSG00000041923
AA Change: D375G

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
low complexity region 560 579 N/A INTRINSIC
low complexity region 586 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164893
AA Change: D375G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127870
Gene: ENSMUSG00000041923
AA Change: D375G

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
low complexity region 496 515 N/A INTRINSIC
low complexity region 522 532 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Nol4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Nol4 APN 18 22823412 missense probably benign 0.15
IGL00677:Nol4 APN 18 22921867 missense probably damaging 1.00
IGL01153:Nol4 APN 18 22769793 missense probably damaging 1.00
IGL01400:Nol4 APN 18 22823498 missense probably damaging 0.99
IGL02006:Nol4 APN 18 22921918 missense probably damaging 1.00
IGL02342:Nol4 APN 18 22770869 splice site probably benign
IGL02501:Nol4 APN 18 22823341 missense probably damaging 1.00
PIT4378001:Nol4 UTSW 18 23039876 missense probably damaging 1.00
R0096:Nol4 UTSW 18 22921858 missense possibly damaging 0.95
R0097:Nol4 UTSW 18 22719141 missense probably benign 0.23
R0097:Nol4 UTSW 18 22719141 missense probably benign 0.23
R1257:Nol4 UTSW 18 22770681 missense probably damaging 1.00
R1793:Nol4 UTSW 18 22769821 missense probably damaging 1.00
R2101:Nol4 UTSW 18 22823409 missense probably damaging 1.00
R2357:Nol4 UTSW 18 23039910 missense probably benign 0.01
R2414:Nol4 UTSW 18 22823572 critical splice acceptor site probably null
R2427:Nol4 UTSW 18 22850698 intron probably benign
R3713:Nol4 UTSW 18 23039937 missense probably damaging 1.00
R3734:Nol4 UTSW 18 22770864 splice site probably benign
R3803:Nol4 UTSW 18 22694955 missense probably damaging 1.00
R4458:Nol4 UTSW 18 22751995 missense probably damaging 0.99
R4736:Nol4 UTSW 18 22718993 missense probably damaging 1.00
R4774:Nol4 UTSW 18 22912626 missense probably damaging 0.96
R4795:Nol4 UTSW 18 22921887 missense probably damaging 1.00
R5245:Nol4 UTSW 18 22695122 makesense probably null
R5980:Nol4 UTSW 18 22952201 missense probably damaging 0.97
R6372:Nol4 UTSW 18 23038556 critical splice donor site probably null
R6614:Nol4 UTSW 18 22920856 missense probably damaging 1.00
R6809:Nol4 UTSW 18 22920825 missense probably damaging 1.00
R6877:Nol4 UTSW 18 22719129 missense probably benign 0.06
R7269:Nol4 UTSW 18 23039789 missense probably benign
R7310:Nol4 UTSW 18 22770744 missense
R7720:Nol4 UTSW 18 23040023 missense probably benign 0.16
R7753:Nol4 UTSW 18 23038602 start codon destroyed probably benign 0.15
R7897:Nol4 UTSW 18 22823343 missense
R7974:Nol4 UTSW 18 22719025 nonsense probably null
R8297:Nol4 UTSW 18 23040012 missense probably damaging 0.99
R8303:Nol4 UTSW 18 23040174 unclassified probably benign
Z1088:Nol4 UTSW 18 22921902 missense probably damaging 1.00
Z1177:Nol4 UTSW 18 22769840 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTTCTAAAATATTCACACTGACCGAC -3'
(R):5'- AATGCCACCTATCTAGAGTTACC -3'

Sequencing Primer
(F):5'- CGACAAGCAACAGCATGAATGTG -3'
(R):5'- GGGACAATCAATGTCACC -3'
Posted On2018-05-21