Incidental Mutation 'R6485:Ripply1'
ID517324
Institutional Source Beutler Lab
Gene Symbol Ripply1
Ensembl Gene ENSMUSG00000072945
Gene Nameripply transcriptional repressor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6485 (G1)
Quality Score134.467
Status Not validated
ChromosomeX
Chromosomal Location139779549-139782353 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT to TTCCTCCTCCTCCTCCTCCTCCTCCTCCT at 139779850 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101217]
Predicted Effect probably benign
Transcript: ENSMUST00000101217
SMART Domains Protein: ENSMUSP00000098778
Gene: ENSMUSG00000072945

DomainStartEndE-ValueType
low complexity region 2 44 N/A INTRINSIC
Pfam:Ripply 59 150 3.1e-36 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit extension of the seventh cervical vertebrae that fuses with the first rib. However, mice are otherwise viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Ripply1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0464:Ripply1 UTSW X 139779850 small deletion probably benign
R5388:Ripply1 UTSW X 139779850 small deletion probably benign
R5397:Ripply1 UTSW X 139779850 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAGGACACTGGTTTCAATCCAG -3'
(R):5'- TCTGTCCACAGGCTCTACTG -3'

Sequencing Primer
(F):5'- GAGACTCTTTGCGAATCGATGCC -3'
(R):5'- AGGCTCTACTGGCCCAAGTC -3'
Posted On2018-05-21