Incidental Mutation 'R6486:Epha4'
ID517325
Institutional Source Beutler Lab
Gene Symbol Epha4
Ensembl Gene ENSMUSG00000026235
Gene NameEph receptor A4
Synonymsrb, Sek, Sek1, 2900005C20Rik, Cek8, Hek8, Tyro1
MMRRC Submission
Accession Numbers

Genbank: NM_007936; MGI: 98277

Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R6486 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location77367185-77515088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77383549 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 704 (N704D)
Ref Sequence ENSEMBL: ENSMUSP00000139640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027451] [ENSMUST00000188797] [ENSMUST00000188952] [ENSMUST00000190149]
PDB Structure
THE CRYSTAL STRUCTURE OF AN EPH RECEPTOR SAM DOMAIN REVEALS A MECHANISM FOR MODULAR DIMERIZATION. [X-RAY DIFFRACTION]
Crystal structure of a mutant EphA4 kinase domain (Y742A) [X-RAY DIFFRACTION]
[]
Crystal structure of EphA4 kinase domain in complex with VUF 12058 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF EPHA4 KINASE DOMAIN [X-RAY DIFFRACTION]
Crystal structure of EphA4 kinase domain in complex with Dasatinib. [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027451
AA Change: N704D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027451
Gene: ENSMUSG00000026235
AA Change: N704D

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 548 618 1.7e-24 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188797
AA Change: N704D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235
AA Change: N704D

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188952
AA Change: N704D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139640
Gene: ENSMUSG00000026235
AA Change: N704D

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190149
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mutants are known for their "hopping gait". Homozygotes for targeted null mutations show loss of limb alternation in locomotion and axon guidance defects of the corticospinal tract within medulla and spinal cord, resulting in aberrant midline projections. Heterozygotes show less severe phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(66) : Targeted, knock-out(3) Targeted, other(9) Gene trapped(52) Spontaneous(2)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1d T A 14: 30,114,233 M853L probably benign Het
Cacna2d1 C T 5: 16,319,450 probably null Het
Capg G T 6: 72,557,750 E187* probably null Het
Carns1 C T 19: 4,169,980 A419T probably benign Het
Cpt1b A G 15: 89,420,824 M407T probably benign Het
Dlg2 A T 7: 91,872,374 probably null Het
Ep400 T C 5: 110,697,218 probably benign Het
Gga2 A G 7: 122,002,188 S231P probably damaging Het
Gpbp1l1 A G 4: 116,581,375 K223E probably damaging Het
Homer1 A T 13: 93,391,725 N78I possibly damaging Het
Lmbr1 C T 5: 29,323,861 V122M probably damaging Het
Mpeg1 C A 19: 12,462,105 A309E probably damaging Het
Myo18a A G 11: 77,864,822 E1713G possibly damaging Het
Neto1 A G 18: 86,461,246 I186M probably benign Het
Nfasc T C 1: 132,605,214 D668G probably damaging Het
Nlrc5 T C 8: 94,521,299 probably null Het
Olfr1489 T G 19: 13,633,691 N193K probably damaging Het
Olfr251 G A 9: 38,377,904 V2I probably benign Het
Olfr339 A T 2: 36,421,544 I49F probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prkdc T C 16: 15,752,764 S2304P probably damaging Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Slc8b1 T C 5: 120,533,002 F551S probably damaging Het
Stra6 TC T 9: 58,151,422 probably null Het
Tlr3 T C 8: 45,398,613 probably null Het
Tnfrsf22 T C 7: 143,640,756 T145A possibly damaging Het
Trp63 A T 16: 25,865,340 T326S probably damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Vmn1r234 A T 17: 21,229,342 M173L probably benign Het
Vmn2r13 T G 5: 109,156,559 I669L probably benign Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Other mutations in Epha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Epha4 APN 1 77398557 missense probably benign 0.00
IGL01350:Epha4 APN 1 77506855 missense probably damaging 1.00
IGL01657:Epha4 APN 1 77426838 missense probably damaging 1.00
IGL01872:Epha4 APN 1 77383039 missense probably benign 0.03
IGL02366:Epha4 APN 1 77426711 nonsense probably null
IGL02426:Epha4 APN 1 77444877 missense probably benign 0.01
IGL02428:Epha4 APN 1 77506748 missense possibly damaging 0.94
IGL02706:Epha4 APN 1 77426845 missense probably damaging 1.00
IGL02716:Epha4 APN 1 77380965 missense probably damaging 1.00
IGL03348:Epha4 APN 1 77507172 missense possibly damaging 0.82
frog UTSW 1 77481076 intron probably benign
R0324:Epha4 UTSW 1 77383551 missense probably damaging 1.00
R0392:Epha4 UTSW 1 77506973 missense probably benign 0.00
R0538:Epha4 UTSW 1 77388541 missense probably damaging 1.00
R0562:Epha4 UTSW 1 77388487 missense probably benign 0.00
R0885:Epha4 UTSW 1 77382939 missense probably damaging 0.99
R1509:Epha4 UTSW 1 77380886 missense probably damaging 1.00
R1620:Epha4 UTSW 1 77374926 missense probably benign 0.31
R1624:Epha4 UTSW 1 77399692 missense probably damaging 1.00
R1654:Epha4 UTSW 1 77374768 splice site probably null
R1755:Epha4 UTSW 1 77387823 missense probably damaging 1.00
R1807:Epha4 UTSW 1 77374904 missense probably benign 0.05
R2046:Epha4 UTSW 1 77507162 missense probably damaging 1.00
R2504:Epha4 UTSW 1 77382991 missense probably damaging 1.00
R2509:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R2511:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R3441:Epha4 UTSW 1 77426696 missense possibly damaging 0.90
R3724:Epha4 UTSW 1 77426543 splice site probably benign
R3901:Epha4 UTSW 1 77380902 missense probably damaging 1.00
R3950:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3951:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3952:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R4012:Epha4 UTSW 1 77390094 splice site probably benign
R4321:Epha4 UTSW 1 77507213 critical splice acceptor site probably null
R4422:Epha4 UTSW 1 77511717 missense probably damaging 0.99
R4898:Epha4 UTSW 1 77390075 nonsense probably null
R5072:Epha4 UTSW 1 77445002 missense probably damaging 1.00
R5270:Epha4 UTSW 1 77506607 missense probably damaging 1.00
R5281:Epha4 UTSW 1 77374867 missense probably benign
R5315:Epha4 UTSW 1 77388472 critical splice donor site probably null
R5531:Epha4 UTSW 1 77374876 missense probably benign
R5621:Epha4 UTSW 1 77515049 utr 5 prime probably benign
R5648:Epha4 UTSW 1 77398525 missense probably benign 0.25
R5747:Epha4 UTSW 1 77506883 missense probably damaging 0.99
R5829:Epha4 UTSW 1 77444994 missense probably benign 0.01
R6185:Epha4 UTSW 1 77507106 missense probably damaging 1.00
R6821:Epha4 UTSW 1 77382945 missense possibly damaging 0.88
R6978:Epha4 UTSW 1 77377583 missense probably damaging 1.00
R7039:Epha4 UTSW 1 77506785 missense probably damaging 1.00
R7216:Epha4 UTSW 1 77444984 missense probably damaging 1.00
R7270:Epha4 UTSW 1 77399785 missense probably damaging 1.00
R7444:Epha4 UTSW 1 77387916 missense probably damaging 1.00
R7737:Epha4 UTSW 1 77381012 missense probably damaging 1.00
R7763:Epha4 UTSW 1 77390031 critical splice donor site probably null
Z1088:Epha4 UTSW 1 77506662 missense possibly damaging 0.61
Z1176:Epha4 UTSW 1 77373733 makesense probably null
Z1176:Epha4 UTSW 1 77383011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCATGGATTATTCAATAGCC -3'
(R):5'- TGGAATGTAAGCCTATGTGTCC -3'

Sequencing Primer
(F):5'- CCCATGGATTATTCAATAGCCTTAAG -3'
(R):5'- TTGCTCCCCACAGCTGAG -3'
Posted On2018-05-21