Incidental Mutation 'R6486:Gpbp1l1'
ID 517328
Institutional Source Beutler Lab
Gene Symbol Gpbp1l1
Ensembl Gene ENSMUSG00000034042
Gene Name GC-rich promoter binding protein 1-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6486 (G1)
Quality Score 113.008
Status Validated
Chromosome 4
Chromosomal Location 116557658-116593882 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116581375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 223 (K223E)
Ref Sequence ENSEMBL: ENSMUSP00000102083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030460] [ENSMUST00000106475]
AlphaFold Q6NZP2
Predicted Effect probably damaging
Transcript: ENSMUST00000030460
AA Change: K223E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030460
Gene: ENSMUSG00000034042
AA Change: K223E

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 376 470 5.1e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106475
AA Change: K223E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102083
Gene: ENSMUSG00000034042
AA Change: K223E

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 377 470 1.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138837
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1d T A 14: 30,114,233 M853L probably benign Het
Cacna2d1 C T 5: 16,319,450 probably null Het
Capg G T 6: 72,557,750 E187* probably null Het
Carns1 C T 19: 4,169,980 A419T probably benign Het
Cpt1b A G 15: 89,420,824 M407T probably benign Het
Dlg2 A T 7: 91,872,374 probably null Het
Ep400 T C 5: 110,697,218 probably benign Het
Epha4 T C 1: 77,383,549 N704D probably damaging Het
Gga2 A G 7: 122,002,188 S231P probably damaging Het
Homer1 A T 13: 93,391,725 N78I possibly damaging Het
Lmbr1 C T 5: 29,323,861 V122M probably damaging Het
Mpeg1 C A 19: 12,462,105 A309E probably damaging Het
Myo18a A G 11: 77,864,822 E1713G possibly damaging Het
Neto1 A G 18: 86,461,246 I186M probably benign Het
Nfasc T C 1: 132,605,214 D668G probably damaging Het
Nlrc5 T C 8: 94,521,299 probably null Het
Olfr1489 T G 19: 13,633,691 N193K probably damaging Het
Olfr251 G A 9: 38,377,904 V2I probably benign Het
Olfr339 A T 2: 36,421,544 I49F probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prkdc T C 16: 15,752,764 S2304P probably damaging Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Slc8b1 T C 5: 120,533,002 F551S probably damaging Het
Stra6 TC T 9: 58,151,422 probably null Het
Tlr3 T C 8: 45,398,613 probably null Het
Tnfrsf22 T C 7: 143,640,756 T145A possibly damaging Het
Trp63 A T 16: 25,865,340 T326S probably damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Vmn1r234 A T 17: 21,229,342 M173L probably benign Het
Vmn2r13 T G 5: 109,156,559 I669L probably benign Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Other mutations in Gpbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Gpbp1l1 APN 4 116587513 critical splice donor site probably null
IGL03342:Gpbp1l1 APN 4 116574543 missense probably benign
R0534:Gpbp1l1 UTSW 4 116591268 missense probably damaging 1.00
R0964:Gpbp1l1 UTSW 4 116581239 splice site probably benign
R1136:Gpbp1l1 UTSW 4 116592918 missense probably damaging 1.00
R1169:Gpbp1l1 UTSW 4 116574366 missense possibly damaging 0.53
R3975:Gpbp1l1 UTSW 4 116570985 critical splice donor site probably null
R4296:Gpbp1l1 UTSW 4 116587459 missense possibly damaging 0.80
R4676:Gpbp1l1 UTSW 4 116590265 missense probably damaging 1.00
R4870:Gpbp1l1 UTSW 4 116573517 missense probably benign
R5086:Gpbp1l1 UTSW 4 116588592 missense probably benign 0.04
R5931:Gpbp1l1 UTSW 4 116590260 missense probably benign 0.00
R6604:Gpbp1l1 UTSW 4 116573505 missense probably benign 0.09
R6973:Gpbp1l1 UTSW 4 116581282 missense possibly damaging 0.53
R7031:Gpbp1l1 UTSW 4 116592848 missense probably damaging 1.00
R7230:Gpbp1l1 UTSW 4 116588610 missense probably damaging 0.99
R7286:Gpbp1l1 UTSW 4 116590245 missense probably benign 0.02
R7368:Gpbp1l1 UTSW 4 116573458 missense probably benign 0.04
R7791:Gpbp1l1 UTSW 4 116574420 missense probably damaging 1.00
R9475:Gpbp1l1 UTSW 4 116574361 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCATCTCCTATGTTGAAGGTGAGG -3'
(R):5'- ACTGGCAGAGTCTGGTAATGG -3'

Sequencing Primer
(F):5'- TGAAGGTGAGGATGTTGTTTAAAC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On 2018-05-21