Incidental Mutation 'R6486:Unc45a'
ID517335
Institutional Source Beutler Lab
Gene Symbol Unc45a
Ensembl Gene ENSMUSG00000030533
Gene Nameunc-45 myosin chaperone A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6486 (G1)
Quality Score87.0076
Status Validated
Chromosome7
Chromosomal Location80325292-80341005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 80339652 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 23 (E23Q)
Ref Sequence ENSEMBL: ENSMUSP00000114428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032747] [ENSMUST00000032748] [ENSMUST00000107368] [ENSMUST00000127997] [ENSMUST00000133728] [ENSMUST00000154428] [ENSMUST00000205531] [ENSMUST00000205744] [ENSMUST00000205768] [ENSMUST00000206122] [ENSMUST00000206074] [ENSMUST00000206089] [ENSMUST00000206480]
Predicted Effect probably benign
Transcript: ENSMUST00000032747
SMART Domains Protein: ENSMUSP00000032747
Gene: ENSMUSG00000030532

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
HDc 28 136 1.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032748
AA Change: E38Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533
AA Change: E38Q

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107368
AA Change: E38Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533
AA Change: E38Q

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127997
AA Change: E23Q

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114428
Gene: ENSMUSG00000030533
AA Change: E23Q

DomainStartEndE-ValueType
Pfam:TPR_11 4 74 8.4e-19 PFAM
Pfam:TPR_1 6 36 2.3e-6 PFAM
Pfam:TPR_2 6 37 2.6e-6 PFAM
Pfam:TPR_16 10 82 1e-7 PFAM
Pfam:TPR_1 43 69 4.4e-4 PFAM
Pfam:TPR_2 43 74 3.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133728
AA Change: E23Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123399
Gene: ENSMUSG00000030533
AA Change: E23Q

DomainStartEndE-ValueType
TPR 6 39 9.53e-2 SMART
TPR 43 76 5.48e-2 SMART
TPR 77 110 7.45e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145351
Predicted Effect probably benign
Transcript: ENSMUST00000154428
AA Change: E38Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533
AA Change: E38Q

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205448
Predicted Effect probably benign
Transcript: ENSMUST00000205531
Predicted Effect probably benign
Transcript: ENSMUST00000205744
Predicted Effect probably benign
Transcript: ENSMUST00000205768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206032
Predicted Effect probably benign
Transcript: ENSMUST00000206122
Predicted Effect probably benign
Transcript: ENSMUST00000206363
Predicted Effect probably benign
Transcript: ENSMUST00000206074
Predicted Effect probably benign
Transcript: ENSMUST00000206089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206494
Predicted Effect probably benign
Transcript: ENSMUST00000206480
Predicted Effect probably benign
Transcript: ENSMUST00000206559
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC45A plays a role in cell proliferation and myoblast fusion, binds progesterone receptor (PGR; MIM 607311) and HSP90 (HSPCA; MIM 140571), and acts as a regulator of the progesterone receptor chaperoning pathway (Price et al., 2002 [PubMed 12356907]; Chadli et al., 2006 [PubMed 16478993]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1d T A 14: 30,114,233 M853L probably benign Het
Cacna2d1 C T 5: 16,319,450 probably null Het
Capg G T 6: 72,557,750 E187* probably null Het
Carns1 C T 19: 4,169,980 A419T probably benign Het
Cpt1b A G 15: 89,420,824 M407T probably benign Het
Dlg2 A T 7: 91,872,374 probably null Het
Ep400 T C 5: 110,697,218 probably benign Het
Epha4 T C 1: 77,383,549 N704D probably damaging Het
Gga2 A G 7: 122,002,188 S231P probably damaging Het
Gpbp1l1 A G 4: 116,581,375 K223E probably damaging Het
Homer1 A T 13: 93,391,725 N78I possibly damaging Het
Lmbr1 C T 5: 29,323,861 V122M probably damaging Het
Mpeg1 C A 19: 12,462,105 A309E probably damaging Het
Myo18a A G 11: 77,864,822 E1713G possibly damaging Het
Neto1 A G 18: 86,461,246 I186M probably benign Het
Nfasc T C 1: 132,605,214 D668G probably damaging Het
Nlrc5 T C 8: 94,521,299 probably null Het
Olfr1489 T G 19: 13,633,691 N193K probably damaging Het
Olfr251 G A 9: 38,377,904 V2I probably benign Het
Olfr339 A T 2: 36,421,544 I49F probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prkdc T C 16: 15,752,764 S2304P probably damaging Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Slc8b1 T C 5: 120,533,002 F551S probably damaging Het
Stra6 TC T 9: 58,151,422 probably null Het
Tlr3 T C 8: 45,398,613 probably null Het
Tnfrsf22 T C 7: 143,640,756 T145A possibly damaging Het
Trp63 A T 16: 25,865,340 T326S probably damaging Het
Vmn1r234 A T 17: 21,229,342 M173L probably benign Het
Vmn2r13 T G 5: 109,156,559 I669L probably benign Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Other mutations in Unc45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02252:Unc45a APN 7 80332969 intron probably benign
IGL02266:Unc45a APN 7 80328486 missense probably damaging 0.96
IGL02383:Unc45a APN 7 80339662 nonsense probably null
IGL02959:Unc45a APN 7 80332973 intron probably benign
IGL03168:Unc45a APN 7 80333133 missense probably damaging 1.00
PIT4131001:Unc45a UTSW 7 80326361 missense possibly damaging 0.74
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0276:Unc45a UTSW 7 80326297 intron probably benign
R0373:Unc45a UTSW 7 80326344 missense probably damaging 0.97
R1827:Unc45a UTSW 7 80331740 missense possibly damaging 0.77
R2120:Unc45a UTSW 7 80340098 missense probably benign 0.29
R2440:Unc45a UTSW 7 80329057 missense probably damaging 1.00
R2442:Unc45a UTSW 7 80339669 missense probably damaging 1.00
R2508:Unc45a UTSW 7 80338875 missense probably benign
R3077:Unc45a UTSW 7 80338932 missense probably damaging 0.97
R3108:Unc45a UTSW 7 80331546 intron probably benign
R3109:Unc45a UTSW 7 80331546 intron probably benign
R3620:Unc45a UTSW 7 80334051 missense possibly damaging 0.84
R4471:Unc45a UTSW 7 80332980 missense possibly damaging 0.94
R4644:Unc45a UTSW 7 80328509 missense probably damaging 1.00
R4651:Unc45a UTSW 7 80333029 missense possibly damaging 0.93
R4838:Unc45a UTSW 7 80333035 missense probably damaging 1.00
R5234:Unc45a UTSW 7 80328799 missense probably benign 0.17
R5452:Unc45a UTSW 7 80329039 missense probably damaging 1.00
R5574:Unc45a UTSW 7 80334856 missense probably damaging 0.98
R5750:Unc45a UTSW 7 80334823 missense probably benign 0.17
R6169:Unc45a UTSW 7 80328763 missense possibly damaging 0.92
R6417:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6420:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6533:Unc45a UTSW 7 80334069 missense probably damaging 1.00
R6734:Unc45a UTSW 7 80336998 missense probably damaging 1.00
R6993:Unc45a UTSW 7 80325655 missense probably damaging 1.00
R7085:Unc45a UTSW 7 80326334 missense possibly damaging 0.87
R7180:Unc45a UTSW 7 80329821 splice site probably null
R7561:Unc45a UTSW 7 80331586 missense possibly damaging 0.63
R8079:Unc45a UTSW 7 80331562 missense probably damaging 1.00
R8395:Unc45a UTSW 7 80326332 missense probably benign 0.08
R8547:Unc45a UTSW 7 80326092 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AAATGCCCAACTGGTGCAC -3'
(R):5'- GGTCGCCGTCACCTTATTCTAG -3'

Sequencing Primer
(F):5'- TGCACAAACAGCAGCGG -3'
(R):5'- TTCACGGGACTCGGCCAAG -3'
Posted On2018-05-21