Incidental Mutation 'R6486:Gga2'
ID517337
Institutional Source Beutler Lab
Gene Symbol Gga2
Ensembl Gene ENSMUSG00000030872
Gene Namegolgi associated, gamma adaptin ear containing, ARF binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6486 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location121986722-122021222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122002188 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 231 (S231P)
Ref Sequence ENSEMBL: ENSMUSP00000115581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033160] [ENSMUST00000124566]
Predicted Effect probably damaging
Transcript: ENSMUST00000033160
AA Change: S231P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033160
Gene: ENSMUSG00000030872
AA Change: S231P

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
VHS 29 162 2.45e-58 SMART
Pfam:GAT 241 318 2.2e-20 PFAM
low complexity region 320 338 N/A INTRINSIC
Alpha_adaptinC2 471 595 8.68e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124566
AA Change: S231P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115581
Gene: ENSMUSG00000030872
AA Change: S231P

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
VHS 29 162 2.45e-58 SMART
Pfam:GAT 225 326 1.3e-30 PFAM
Alpha_adaptinC2 471 595 8.68e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145277
Meta Mutation Damage Score 0.2934 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. This family member may play a significant role in cargo molecules regulation and clathrin-coated vesicle assembly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality. Mice homozygous for a different gene trapped allele show decreased birth weight, hypoglycemia and partial neonatal lethality, with all remaining mice dying within the first three weeks of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1d T A 14: 30,114,233 M853L probably benign Het
Cacna2d1 C T 5: 16,319,450 probably null Het
Capg G T 6: 72,557,750 E187* probably null Het
Carns1 C T 19: 4,169,980 A419T probably benign Het
Cpt1b A G 15: 89,420,824 M407T probably benign Het
Dlg2 A T 7: 91,872,374 probably null Het
Ep400 T C 5: 110,697,218 probably benign Het
Epha4 T C 1: 77,383,549 N704D probably damaging Het
Gpbp1l1 A G 4: 116,581,375 K223E probably damaging Het
Homer1 A T 13: 93,391,725 N78I possibly damaging Het
Lmbr1 C T 5: 29,323,861 V122M probably damaging Het
Mpeg1 C A 19: 12,462,105 A309E probably damaging Het
Myo18a A G 11: 77,864,822 E1713G possibly damaging Het
Neto1 A G 18: 86,461,246 I186M probably benign Het
Nfasc T C 1: 132,605,214 D668G probably damaging Het
Nlrc5 T C 8: 94,521,299 probably null Het
Olfr1489 T G 19: 13,633,691 N193K probably damaging Het
Olfr251 G A 9: 38,377,904 V2I probably benign Het
Olfr339 A T 2: 36,421,544 I49F probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prkdc T C 16: 15,752,764 S2304P probably damaging Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Slc8b1 T C 5: 120,533,002 F551S probably damaging Het
Stra6 TC T 9: 58,151,422 probably null Het
Tlr3 T C 8: 45,398,613 probably null Het
Tnfrsf22 T C 7: 143,640,756 T145A possibly damaging Het
Trp63 A T 16: 25,865,340 T326S probably damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Vmn1r234 A T 17: 21,229,342 M173L probably benign Het
Vmn2r13 T G 5: 109,156,559 I669L probably benign Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Other mutations in Gga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Gga2 APN 7 122002188 missense probably damaging 1.00
IGL01577:Gga2 APN 7 121989783 missense probably damaging 1.00
IGL01584:Gga2 APN 7 121991538 missense probably benign
IGL01671:Gga2 APN 7 121994856 missense probably benign 0.01
IGL01680:Gga2 APN 7 121998076 missense probably benign 0.06
IGL02745:Gga2 APN 7 122008369 missense probably damaging 1.00
R0122:Gga2 UTSW 7 121991574 missense probably damaging 1.00
R0218:Gga2 UTSW 7 121998900 missense possibly damaging 0.46
R1367:Gga2 UTSW 7 121998915 nonsense probably null
R1774:Gga2 UTSW 7 122012221 missense probably damaging 0.98
R4127:Gga2 UTSW 7 122002720 missense probably damaging 1.00
R4510:Gga2 UTSW 7 122021078 missense unknown
R6319:Gga2 UTSW 7 122002166 missense possibly damaging 0.92
R6395:Gga2 UTSW 7 122008438 splice site probably null
R6952:Gga2 UTSW 7 121998888 missense probably benign 0.00
R7035:Gga2 UTSW 7 121989716 missense probably damaging 1.00
R7320:Gga2 UTSW 7 122002103 missense probably benign
R7454:Gga2 UTSW 7 122002146 missense probably benign 0.00
R7593:Gga2 UTSW 7 121990449 missense probably benign 0.00
R7602:Gga2 UTSW 7 121997330 missense probably benign 0.05
R7638:Gga2 UTSW 7 122003934 missense probably damaging 1.00
R7736:Gga2 UTSW 7 121990524 missense probably damaging 1.00
R8032:Gga2 UTSW 7 122020987 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCTCCAGACCAGAATGGCAG -3'
(R):5'- AGACGATATTGTCACCTGCAGG -3'

Sequencing Primer
(F):5'- TGGCAGCCACAGAACACATG -3'
(R):5'- TCACCTGCAGGAATTCTGG -3'
Posted On2018-05-21