Incidental Mutation 'R6486:Neto1'
ID517351
Institutional Source Beutler Lab
Gene Symbol Neto1
Ensembl Gene ENSMUSG00000050321
Gene Nameneuropilin (NRP) and tolloid (TLL)-like 1
SynonymsC130005O10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6486 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location86394952-86501897 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86461246 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 186 (I186M)
Ref Sequence ENSEMBL: ENSMUSP00000057340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058829]
Predicted Effect probably benign
Transcript: ENSMUST00000058829
AA Change: I186M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057340
Gene: ENSMUSG00000050321
AA Change: I186M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 41 155 2.06e-35 SMART
CUB 172 287 3.1e-7 SMART
LDLa 291 328 3.11e-3 SMART
transmembrane domain 341 363 N/A INTRINSIC
low complexity region 485 497 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in mice encodes a protein that plays a critical role in spatial learning and memory by regulating the function of synaptic N-methyl-D-aspartic acid receptor complexes in the hippocampus. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit depressed long term potentiation, reduced NMDAR excitatory postsynaptic potentiation, and decreased spartial learning and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1d T A 14: 30,114,233 M853L probably benign Het
Cacna2d1 C T 5: 16,319,450 probably null Het
Capg G T 6: 72,557,750 E187* probably null Het
Carns1 C T 19: 4,169,980 A419T probably benign Het
Cpt1b A G 15: 89,420,824 M407T probably benign Het
Dlg2 A T 7: 91,872,374 probably null Het
Ep400 T C 5: 110,697,218 probably benign Het
Epha4 T C 1: 77,383,549 N704D probably damaging Het
Gga2 A G 7: 122,002,188 S231P probably damaging Het
Gpbp1l1 A G 4: 116,581,375 K223E probably damaging Het
Homer1 A T 13: 93,391,725 N78I possibly damaging Het
Lmbr1 C T 5: 29,323,861 V122M probably damaging Het
Mpeg1 C A 19: 12,462,105 A309E probably damaging Het
Myo18a A G 11: 77,864,822 E1713G possibly damaging Het
Nfasc T C 1: 132,605,214 D668G probably damaging Het
Nlrc5 T C 8: 94,521,299 probably null Het
Olfr1489 T G 19: 13,633,691 N193K probably damaging Het
Olfr251 G A 9: 38,377,904 V2I probably benign Het
Olfr339 A T 2: 36,421,544 I49F probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prkdc T C 16: 15,752,764 S2304P probably damaging Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Slc8b1 T C 5: 120,533,002 F551S probably damaging Het
Stra6 TC T 9: 58,151,422 probably null Het
Tlr3 T C 8: 45,398,613 probably null Het
Tnfrsf22 T C 7: 143,640,756 T145A possibly damaging Het
Trp63 A T 16: 25,865,340 T326S probably damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Vmn1r234 A T 17: 21,229,342 M173L probably benign Het
Vmn2r13 T G 5: 109,156,559 I669L probably benign Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Other mutations in Neto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Neto1 APN 18 86498812 missense probably damaging 0.98
IGL01505:Neto1 APN 18 86473689 missense possibly damaging 0.82
IGL01511:Neto1 APN 18 86395908 missense possibly damaging 0.96
IGL02704:Neto1 APN 18 86473823 missense probably damaging 1.00
IGL03072:Neto1 APN 18 86498589 missense probably benign 0.23
R0119:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0136:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0299:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0603:Neto1 UTSW 18 86473660 missense possibly damaging 0.95
R0633:Neto1 UTSW 18 86404729 nonsense probably null
R0657:Neto1 UTSW 18 86461320 missense probably benign 0.17
R1395:Neto1 UTSW 18 86398019 splice site probably benign
R1648:Neto1 UTSW 18 86500054 missense probably damaging 1.00
R1852:Neto1 UTSW 18 86395884 start codon destroyed probably null 0.53
R2249:Neto1 UTSW 18 86461274 missense probably benign 0.02
R4418:Neto1 UTSW 18 86404856 missense probably benign
R4476:Neto1 UTSW 18 86404673 missense probably damaging 0.98
R4676:Neto1 UTSW 18 86398302 missense possibly damaging 0.47
R5095:Neto1 UTSW 18 86398281 missense probably benign
R5282:Neto1 UTSW 18 86404873 missense probably damaging 1.00
R5337:Neto1 UTSW 18 86398309 missense probably benign 0.00
R5400:Neto1 UTSW 18 86395908 missense possibly damaging 0.86
R5435:Neto1 UTSW 18 86398263 missense probably benign 0.00
R5632:Neto1 UTSW 18 86498643 missense probably benign 0.00
R5755:Neto1 UTSW 18 86499094 missense probably damaging 0.99
R6272:Neto1 UTSW 18 86494815 missense probably damaging 1.00
R6505:Neto1 UTSW 18 86498574 missense possibly damaging 0.81
R6526:Neto1 UTSW 18 86498748 missense possibly damaging 0.47
R6582:Neto1 UTSW 18 86494860 nonsense probably null
R6887:Neto1 UTSW 18 86498635 missense probably benign 0.16
R7452:Neto1 UTSW 18 86498931 missense probably benign
R7469:Neto1 UTSW 18 86498688 missense probably benign
R7795:Neto1 UTSW 18 86461073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGAAACCATTGCCAGGTTGG -3'
(R):5'- ACAAGTCTCATTTCCAAGAACAGG -3'

Sequencing Primer
(F):5'- CCATTGCCAGGTTGGTAAAAG -3'
(R):5'- GCTAGTAGCAAATTTGACACATGCC -3'
Posted On2018-05-21