Incidental Mutation 'R6486:Carns1'
ID517352
Institutional Source Beutler Lab
Gene Symbol Carns1
Ensembl Gene ENSMUSG00000075289
Gene Namecarnosine synthase 1
SynonymsAtpgd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6486 (G1)
Quality Score218.009
Status Validated
Chromosome19
Chromosomal Location4164324-4175479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4169980 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 419 (A419T)
Ref Sequence ENSEMBL: ENSMUSP00000131624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167055]
Predicted Effect probably benign
Transcript: ENSMUST00000167055
AA Change: A419T

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000131624
Gene: ENSMUSG00000075289
AA Change: A419T

DomainStartEndE-ValueType
low complexity region 206 217 N/A INTRINSIC
low complexity region 312 328 N/A INTRINSIC
low complexity region 332 348 N/A INTRINSIC
low complexity region 399 410 N/A INTRINSIC
low complexity region 414 433 N/A INTRINSIC
low complexity region 490 496 N/A INTRINSIC
Pfam:ATP-grasp_4 620 819 4.1e-46 PFAM
low complexity region 862 875 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181211
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CARNS1 (EC 6.3.2.11), a member of the ATP-grasp family of ATPases, catalyzes the formation of carnosine (beta-alanyl-L-histidine) and homocarnosine (gamma-aminobutyryl-L-histidine), which are found mainly in skeletal muscle and the central nervous system, respectively (Drozak et al., 2010 [PubMed 20097752]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1d T A 14: 30,114,233 M853L probably benign Het
Cacna2d1 C T 5: 16,319,450 probably null Het
Capg G T 6: 72,557,750 E187* probably null Het
Cpt1b A G 15: 89,420,824 M407T probably benign Het
Dlg2 A T 7: 91,872,374 probably null Het
Ep400 T C 5: 110,697,218 probably benign Het
Epha4 T C 1: 77,383,549 N704D probably damaging Het
Gga2 A G 7: 122,002,188 S231P probably damaging Het
Gpbp1l1 A G 4: 116,581,375 K223E probably damaging Het
Homer1 A T 13: 93,391,725 N78I possibly damaging Het
Lmbr1 C T 5: 29,323,861 V122M probably damaging Het
Mpeg1 C A 19: 12,462,105 A309E probably damaging Het
Myo18a A G 11: 77,864,822 E1713G possibly damaging Het
Neto1 A G 18: 86,461,246 I186M probably benign Het
Nfasc T C 1: 132,605,214 D668G probably damaging Het
Nlrc5 T C 8: 94,521,299 probably null Het
Olfr1489 T G 19: 13,633,691 N193K probably damaging Het
Olfr251 G A 9: 38,377,904 V2I probably benign Het
Olfr339 A T 2: 36,421,544 I49F probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prkdc T C 16: 15,752,764 S2304P probably damaging Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Slc8b1 T C 5: 120,533,002 F551S probably damaging Het
Stra6 TC T 9: 58,151,422 probably null Het
Tlr3 T C 8: 45,398,613 probably null Het
Tnfrsf22 T C 7: 143,640,756 T145A possibly damaging Het
Trp63 A T 16: 25,865,340 T326S probably damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Vmn1r234 A T 17: 21,229,342 M173L probably benign Het
Vmn2r13 T G 5: 109,156,559 I669L probably benign Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Other mutations in Carns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Carns1 APN 19 4166499 splice site probably null
IGL02246:Carns1 APN 19 4166432 missense possibly damaging 0.87
IGL02658:Carns1 APN 19 4173084 missense probably benign 0.01
IGL02800:Carns1 APN 19 4166570 splice site probably benign
R1750:Carns1 UTSW 19 4173157 missense possibly damaging 0.63
R1902:Carns1 UTSW 19 4166338 missense probably damaging 1.00
R1935:Carns1 UTSW 19 4165474 missense probably damaging 1.00
R2434:Carns1 UTSW 19 4165449 missense probably damaging 1.00
R2437:Carns1 UTSW 19 4165783 missense possibly damaging 0.69
R3772:Carns1 UTSW 19 4170916 splice site probably benign
R4091:Carns1 UTSW 19 4171683 missense probably damaging 0.96
R4518:Carns1 UTSW 19 4170070 missense probably benign 0.05
R4668:Carns1 UTSW 19 4165476 nonsense probably null
R4737:Carns1 UTSW 19 4170928 intron probably benign
R4751:Carns1 UTSW 19 4166418 missense probably damaging 1.00
R5384:Carns1 UTSW 19 4171901 critical splice acceptor site probably null
R6077:Carns1 UTSW 19 4170876 missense probably benign 0.01
R6373:Carns1 UTSW 19 4166516 missense probably benign 0.41
R6411:Carns1 UTSW 19 4166464 missense probably damaging 1.00
R6470:Carns1 UTSW 19 4171783 missense possibly damaging 0.85
R6915:Carns1 UTSW 19 4169913 missense probably benign 0.34
R6981:Carns1 UTSW 19 4170082 missense probably benign 0.00
R7936:Carns1 UTSW 19 4166153 missense probably benign
R8025:Carns1 UTSW 19 4166506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTTCAGCTTAAGGACCACG -3'
(R):5'- AACTGCACTGTGGTCAGGTG -3'

Sequencing Primer
(F):5'- GTGAGAACTAAGTCCACGCCTG -3'
(R):5'- CACTGTGGTCAGGTGGTGTG -3'
Posted On2018-05-21