Incidental Mutation 'R6475:Gm3409'
ID 517371
Institutional Source Beutler Lab
Gene Symbol Gm3409
Ensembl Gene ENSMUSG00000096664
Gene Name predicted gene 3409
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6475 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 146537647-146540427 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 146537786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 37 (H37Q)
Ref Sequence ENSEMBL: ENSMUSP00000142652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110597] [ENSMUST00000110599] [ENSMUST00000199142]
AlphaFold A0A0G2JE67
Predicted Effect possibly damaging
Transcript: ENSMUST00000110597
AA Change: H37Q

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106227
Gene: ENSMUSG00000096664
AA Change: H37Q

DomainStartEndE-ValueType
RasGEFN 66 181 1.96e-3 SMART
low complexity region 265 279 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110599
AA Change: H37Q

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106229
Gene: ENSMUSG00000096664
AA Change: H37Q

DomainStartEndE-ValueType
RasGEFN 66 181 1.96e-3 SMART
low complexity region 265 287 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199142
AA Change: H37Q

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142652
Gene: ENSMUSG00000096664
AA Change: H37Q

DomainStartEndE-ValueType
RasGEFN 66 181 9.5e-6 SMART
low complexity region 269 291 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb5 T A 8: 54,550,575 V44E probably damaging Het
Bmpr2 T A 1: 59,868,344 D865E probably damaging Het
Ccr4 A G 9: 114,492,979 V6A probably benign Het
Cd209a A T 8: 3,747,031 D102E probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Cog4 T A 8: 110,880,894 I671N possibly damaging Het
Col14a1 T G 15: 55,445,822 probably benign Het
Cpne6 A G 14: 55,513,653 D173G probably damaging Het
Daglb G T 5: 143,481,651 V275L probably benign Het
Defb43 G T 14: 63,011,872 probably null Het
Dhx30 A G 9: 110,085,052 V1022A possibly damaging Het
Egfem1 A T 3: 29,657,163 K297M probably damaging Het
Egfr A G 11: 16,891,259 I717V probably benign Het
Eif2ak1 T G 5: 143,818,010 probably null Het
Epb42 T C 2: 121,027,133 Y307C possibly damaging Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fam185a A G 5: 21,425,283 D39G probably benign Het
Fbxl4 T A 4: 22,433,661 D599E probably damaging Het
Fgfr2 T A 7: 130,201,120 T268S probably benign Het
Gabra1 A T 11: 42,162,555 M84K probably benign Het
Gba A G 3: 89,205,928 D222G probably benign Het
Gm4559 A G 7: 142,274,150 C72R unknown Het
Grik4 T C 9: 42,629,008 N292S probably benign Het
Haao A G 17: 83,831,684 S274P possibly damaging Het
Hsd17b4 T A 18: 50,172,262 probably null Het
Igdcc4 A T 9: 65,120,321 S222C probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itgb7 T A 15: 102,216,266 D772V probably benign Het
Kif14 T C 1: 136,527,411 L1607P probably damaging Het
Klf5 A G 14: 99,301,381 T77A probably benign Het
Klhl29 C T 12: 5,091,030 V605I probably damaging Het
Map4k1 T C 7: 28,987,022 V105A probably damaging Het
Mctp2 A T 7: 72,200,344 probably null Het
Med12l A G 3: 59,257,079 E1364G probably damaging Het
Mup9 A T 4: 60,419,806 D30E possibly damaging Het
Naip1 T C 13: 100,409,088 R1311G probably damaging Het
Olfr1306 G A 2: 111,912,859 Q24* probably null Het
Olfr56 C T 11: 49,134,933 T247I probably benign Het
Olfr706 A G 7: 106,886,397 V140A probably benign Het
Olfr945 T A 9: 39,258,082 M197L probably benign Het
Pkd1l3 A C 8: 109,623,212 T230P unknown Het
Pthlh G T 6: 147,257,190 H91N probably damaging Het
Rapgef5 T A 12: 117,718,207 V239D probably damaging Het
Rita1 G A 5: 120,611,570 T26I probably damaging Het
Robo3 T C 9: 37,423,290 T615A probably damaging Het
Rpp38 T C 2: 3,329,607 D86G probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Senp2 G T 16: 22,023,800 V205L probably damaging Het
Sept10 T C 10: 59,192,311 N63D possibly damaging Het
Sez6 A G 11: 77,973,844 Het
Spesp1 C T 9: 62,272,433 V398I probably benign Het
Tmbim7 G A 5: 3,664,319 G19S probably benign Het
Tnni3k A T 3: 154,941,058 L431* probably null Het
Trdn T A 10: 33,464,555 probably null Het
Tubb2a A G 13: 34,075,459 V116A possibly damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Zfp768 A T 7: 127,344,655 F103L probably damaging Het
Zfp799 A G 17: 32,820,846 S149P probably damaging Het
Other mutations in Gm3409
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03403:Gm3409 APN 5 146539524 missense probably benign 0.03
R1928:Gm3409 UTSW 5 146539608 missense probably benign 0.00
R5149:Gm3409 UTSW 5 146537761 missense possibly damaging 0.89
R7299:Gm3409 UTSW 5 146539547 missense probably benign 0.28
R7301:Gm3409 UTSW 5 146539547 missense probably benign 0.28
R7480:Gm3409 UTSW 5 146539501 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTAACCAGAGGCCAGCAG -3'
(R):5'- GGCTCCTGTTCATTTTGAGAAC -3'

Sequencing Primer
(F):5'- AGCAGTAGCCTTACCTGACTTAC -3'
(R):5'- GTTCATTTTGAGAACAGACCTAGG -3'
Posted On 2018-05-21