Incidental Mutation 'R6475:Iqub'
ID517372
Institutional Source Beutler Lab
Gene Symbol Iqub
Ensembl Gene ENSMUSG00000046192
Gene NameIQ motif and ubiquitin domain containing
Synonyms4932408B21Rik, Trs4
MMRRC Submission
Accession Numbers

Genbank: NM_172535; MGI: 3041159

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6475 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24444865-24515067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24449745 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 707 (N707I)
Ref Sequence ENSEMBL: ENSMUSP00000051177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052277]
Predicted Effect probably damaging
Transcript: ENSMUST00000052277
AA Change: N707I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051177
Gene: ENSMUSG00000046192
AA Change: N707I

DomainStartEndE-ValueType
PDB:2DAF|A 119 216 1e-38 PDB
Blast:UBQ 129 199 3e-26 BLAST
low complexity region 218 229 N/A INTRINSIC
low complexity region 289 306 N/A INTRINSIC
IQ 333 355 1.74e-1 SMART
low complexity region 357 383 N/A INTRINSIC
low complexity region 735 742 N/A INTRINSIC
Meta Mutation Damage Score 0.8566 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 96% (54/56)
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb5 T A 8: 54,550,575 V44E probably damaging Het
Bmpr2 T A 1: 59,868,344 D865E probably damaging Het
Ccr4 A G 9: 114,492,979 V6A probably benign Het
Cd209a A T 8: 3,747,031 D102E probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Cog4 T A 8: 110,880,894 I671N possibly damaging Het
Col14a1 T G 15: 55,445,822 probably benign Het
Cpne6 A G 14: 55,513,653 D173G probably damaging Het
Daglb G T 5: 143,481,651 V275L probably benign Het
Defb43 G T 14: 63,011,872 probably null Het
Dhx30 A G 9: 110,085,052 V1022A possibly damaging Het
Egfem1 A T 3: 29,657,163 K297M probably damaging Het
Egfr A G 11: 16,891,259 I717V probably benign Het
Eif2ak1 T G 5: 143,818,010 probably null Het
Epb42 T C 2: 121,027,133 Y307C possibly damaging Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fam185a A G 5: 21,425,283 D39G probably benign Het
Fbxl4 T A 4: 22,433,661 D599E probably damaging Het
Fgfr2 T A 7: 130,201,120 T268S probably benign Het
Gabra1 A T 11: 42,162,555 M84K probably benign Het
Gba A G 3: 89,205,928 D222G probably benign Het
Gm3409 T A 5: 146,537,786 H37Q possibly damaging Het
Gm4559 A G 7: 142,274,150 C72R unknown Het
Grik4 T C 9: 42,629,008 N292S probably benign Het
Haao A G 17: 83,831,684 S274P possibly damaging Het
Hsd17b4 T A 18: 50,172,262 probably null Het
Igdcc4 A T 9: 65,120,321 S222C probably damaging Het
Itgb7 T A 15: 102,216,266 D772V probably benign Het
Kif14 T C 1: 136,527,411 L1607P probably damaging Het
Klf5 A G 14: 99,301,381 T77A probably benign Het
Klhl29 C T 12: 5,091,030 V605I probably damaging Het
Map4k1 T C 7: 28,987,022 V105A probably damaging Het
Mctp2 A T 7: 72,200,344 probably null Het
Med12l A G 3: 59,257,079 E1364G probably damaging Het
Mup9 A T 4: 60,419,806 D30E possibly damaging Het
Naip1 T C 13: 100,409,088 R1311G probably damaging Het
Olfr1306 G A 2: 111,912,859 Q24* probably null Het
Olfr56 C T 11: 49,134,933 T247I probably benign Het
Olfr706 A G 7: 106,886,397 V140A probably benign Het
Olfr945 T A 9: 39,258,082 M197L probably benign Het
Pkd1l3 A C 8: 109,623,212 T230P unknown Het
Pthlh G T 6: 147,257,190 H91N probably damaging Het
Rapgef5 T A 12: 117,718,207 V239D probably damaging Het
Rita1 G A 5: 120,611,570 T26I probably damaging Het
Robo3 T C 9: 37,423,290 T615A probably damaging Het
Rpp38 T C 2: 3,329,607 D86G probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Senp2 G T 16: 22,023,800 V205L probably damaging Het
Sept10 T C 10: 59,192,311 N63D possibly damaging Het
Sez6 A G 11: 77,973,844 Het
Spesp1 C T 9: 62,272,433 V398I probably benign Het
Tmbim7 G A 5: 3,664,319 G19S probably benign Het
Tnni3k A T 3: 154,941,058 L431* probably null Het
Trdn T A 10: 33,464,555 probably null Het
Tubb2a A G 13: 34,075,459 V116A possibly damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Zfp768 A T 7: 127,344,655 F103L probably damaging Het
Zfp799 A G 17: 32,820,846 S149P probably damaging Het
Other mutations in Iqub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Iqub APN 6 24501006 splice site probably benign
IGL01447:Iqub APN 6 24505628 missense probably benign 0.01
IGL01621:Iqub APN 6 24446212 missense probably benign 0.45
IGL01702:Iqub APN 6 24500313 missense probably benign 0.13
IGL01917:Iqub APN 6 24479319 missense probably damaging 0.97
IGL02411:Iqub APN 6 24449811 missense probably damaging 0.98
IGL02580:Iqub APN 6 24501399 missense probably benign 0.06
IGL02704:Iqub APN 6 24505910 splice site probably benign
IGL02901:Iqub APN 6 24454195 missense probably damaging 1.00
D4043:Iqub UTSW 6 24505751 missense possibly damaging 0.81
R0304:Iqub UTSW 6 24454291 missense probably damaging 0.99
R0391:Iqub UTSW 6 24446155 missense probably benign 0.00
R0453:Iqub UTSW 6 24450830 missense probably damaging 1.00
R0464:Iqub UTSW 6 24479263 nonsense probably null
R0465:Iqub UTSW 6 24503784 missense probably damaging 1.00
R0479:Iqub UTSW 6 24505810 missense probably benign 0.28
R0606:Iqub UTSW 6 24501261 splice site probably benign
R1146:Iqub UTSW 6 24505628 missense possibly damaging 0.89
R1146:Iqub UTSW 6 24505628 missense possibly damaging 0.89
R1238:Iqub UTSW 6 24505885 missense probably benign 0.03
R1452:Iqub UTSW 6 24491559 missense probably benign 0.13
R1927:Iqub UTSW 6 24491671 missense probably benign 0.11
R3195:Iqub UTSW 6 24462037 splice site probably benign
R4438:Iqub UTSW 6 24505868 missense probably benign 0.01
R4577:Iqub UTSW 6 24501291 missense probably damaging 0.99
R4671:Iqub UTSW 6 24479184 missense probably benign 0.00
R4860:Iqub UTSW 6 24450842 missense probably damaging 0.99
R4860:Iqub UTSW 6 24450842 missense probably damaging 0.99
R4906:Iqub UTSW 6 24501369 missense probably damaging 0.99
R5605:Iqub UTSW 6 24505621 missense probably benign
R5772:Iqub UTSW 6 24454251 missense possibly damaging 0.64
R5801:Iqub UTSW 6 24449769 missense probably benign 0.11
R5853:Iqub UTSW 6 24491602 missense probably benign 0.00
R6423:Iqub UTSW 6 24491529 missense probably damaging 0.98
R6476:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6477:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6701:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6702:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6703:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6860:Iqub UTSW 6 24505738 missense possibly damaging 0.81
R7331:Iqub UTSW 6 24500394 missense possibly damaging 0.73
R7530:Iqub UTSW 6 24450623 missense probably benign 0.00
R7997:Iqub UTSW 6 24501414 missense possibly damaging 0.86
R8050:Iqub UTSW 6 24503785 missense possibly damaging 0.95
X0025:Iqub UTSW 6 24500384 missense probably damaging 0.96
Z1088:Iqub UTSW 6 24500243 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCCCCAGATAACTGTCTATTGATTC -3'
(R):5'- GATGAATGCTGCACCCCTTG -3'

Sequencing Primer
(F):5'- TTGATTCAGTAGAAACCCTTCAGCC -3'
(R):5'- TGGCATGTAGCTTCAGGA -3'
Posted On2018-05-21