Incidental Mutation 'R6475:Olfr706'
ID517377
Institutional Source Beutler Lab
Gene Symbol Olfr706
Ensembl Gene ENSMUSG00000109354
Gene Nameolfactory receptor 706
SynonymsGA_x6K02T2PBJ9-9271198-9270248, MOR283-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R6475 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106882589-106888162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106886397 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 140 (V140A)
Ref Sequence ENSEMBL: ENSMUSP00000150075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088687] [ENSMUST00000208759] [ENSMUST00000209025] [ENSMUST00000210644] [ENSMUST00000213251] [ENSMUST00000213918] [ENSMUST00000214112]
Predicted Effect probably benign
Transcript: ENSMUST00000088687
SMART Domains Protein: ENSMUSP00000086062
Gene: ENSMUSG00000069390

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 303 9.1e-9 PFAM
Pfam:7tm_1 41 290 1.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208759
Predicted Effect probably benign
Transcript: ENSMUST00000209025
AA Change: V140A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000210644
Predicted Effect probably benign
Transcript: ENSMUST00000213251
Predicted Effect probably benign
Transcript: ENSMUST00000213918
AA Change: V140A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000214112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216099
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb5 T A 8: 54,550,575 V44E probably damaging Het
Bmpr2 T A 1: 59,868,344 D865E probably damaging Het
Ccr4 A G 9: 114,492,979 V6A probably benign Het
Cd209a A T 8: 3,747,031 D102E probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Cog4 T A 8: 110,880,894 I671N possibly damaging Het
Col14a1 T G 15: 55,445,822 probably benign Het
Cpne6 A G 14: 55,513,653 D173G probably damaging Het
Daglb G T 5: 143,481,651 V275L probably benign Het
Defb43 G T 14: 63,011,872 probably null Het
Dhx30 A G 9: 110,085,052 V1022A possibly damaging Het
Egfem1 A T 3: 29,657,163 K297M probably damaging Het
Egfr A G 11: 16,891,259 I717V probably benign Het
Eif2ak1 T G 5: 143,818,010 probably null Het
Epb42 T C 2: 121,027,133 Y307C possibly damaging Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fam185a A G 5: 21,425,283 D39G probably benign Het
Fbxl4 T A 4: 22,433,661 D599E probably damaging Het
Fgfr2 T A 7: 130,201,120 T268S probably benign Het
Gabra1 A T 11: 42,162,555 M84K probably benign Het
Gba A G 3: 89,205,928 D222G probably benign Het
Gm3409 T A 5: 146,537,786 H37Q possibly damaging Het
Gm4559 A G 7: 142,274,150 C72R unknown Het
Grik4 T C 9: 42,629,008 N292S probably benign Het
Haao A G 17: 83,831,684 S274P possibly damaging Het
Hsd17b4 T A 18: 50,172,262 probably null Het
Igdcc4 A T 9: 65,120,321 S222C probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itgb7 T A 15: 102,216,266 D772V probably benign Het
Kif14 T C 1: 136,527,411 L1607P probably damaging Het
Klf5 A G 14: 99,301,381 T77A probably benign Het
Klhl29 C T 12: 5,091,030 V605I probably damaging Het
Map4k1 T C 7: 28,987,022 V105A probably damaging Het
Mctp2 A T 7: 72,200,344 probably null Het
Med12l A G 3: 59,257,079 E1364G probably damaging Het
Mup9 A T 4: 60,419,806 D30E possibly damaging Het
Naip1 T C 13: 100,409,088 R1311G probably damaging Het
Olfr1306 G A 2: 111,912,859 Q24* probably null Het
Olfr56 C T 11: 49,134,933 T247I probably benign Het
Olfr945 T A 9: 39,258,082 M197L probably benign Het
Pkd1l3 A C 8: 109,623,212 T230P unknown Het
Pthlh G T 6: 147,257,190 H91N probably damaging Het
Rapgef5 T A 12: 117,718,207 V239D probably damaging Het
Rita1 G A 5: 120,611,570 T26I probably damaging Het
Robo3 T C 9: 37,423,290 T615A probably damaging Het
Rpp38 T C 2: 3,329,607 D86G probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Senp2 G T 16: 22,023,800 V205L probably damaging Het
Sept10 T C 10: 59,192,311 N63D possibly damaging Het
Sez6 A G 11: 77,973,844 Het
Spesp1 C T 9: 62,272,433 V398I probably benign Het
Tmbim7 G A 5: 3,664,319 G19S probably benign Het
Tnni3k A T 3: 154,941,058 L431* probably null Het
Trdn T A 10: 33,464,555 probably null Het
Tubb2a A G 13: 34,075,459 V116A possibly damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Zfp768 A T 7: 127,344,655 F103L probably damaging Het
Zfp799 A G 17: 32,820,846 S149P probably damaging Het
Other mutations in Olfr706
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02311:Olfr706 APN 7 106885894 missense probably benign 0.00
IGL03093:Olfr706 APN 7 106886203 missense probably benign 0.02
IGL03354:Olfr706 APN 7 106886100 missense probably benign 0.07
R0334:Olfr706 UTSW 7 106886415 missense probably benign 0.00
R1577:Olfr706 UTSW 7 106886010 missense probably benign 0.03
R4083:Olfr706 UTSW 7 106886644 missense probably damaging 0.97
R4399:Olfr706 UTSW 7 106886453 missense probably damaging 1.00
R4421:Olfr706 UTSW 7 106886453 missense probably damaging 1.00
R5202:Olfr706 UTSW 7 106886596 missense possibly damaging 0.90
R6031:Olfr706 UTSW 7 106885927 missense possibly damaging 0.93
R6031:Olfr706 UTSW 7 106885927 missense possibly damaging 0.93
R6375:Olfr706 UTSW 7 106886014 missense probably benign
R7665:Olfr706 UTSW 7 106886673 missense possibly damaging 0.95
R7742:Olfr706 UTSW 7 106886622 missense probably damaging 1.00
R7956:Olfr706 UTSW 7 106885971 missense possibly damaging 0.88
Z1088:Olfr706 UTSW 7 106886296 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCATGAGCTCATATTGGGAGG -3'
(R):5'- GGCAGCTGTCTCTCATTGAC -3'

Sequencing Primer
(F):5'- CTCATATTGGGAGGTATCTACACAGG -3'
(R):5'- CCAAGGCTGTCATGGATTTTC -3'
Posted On2018-05-21