Incidental Mutation 'R6475:Pkd1l3'
ID517383
Institutional Source Beutler Lab
Gene Symbol Pkd1l3
Ensembl Gene ENSMUSG00000048827
Gene Namepolycystic kidney disease 1 like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6475 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location109614517-109674386 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 109623212 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 230 (T230P)
Ref Sequence ENSEMBL: ENSMUSP00000148592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057344] [ENSMUST00000109242] [ENSMUST00000212537]
Predicted Effect unknown
Transcript: ENSMUST00000057344
AA Change: T230P
SMART Domains Protein: ENSMUSP00000051512
Gene: ENSMUSG00000048827
AA Change: T230P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.25e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 431 1.22e-8 PROSPERO
internal_repeat_2 378 466 2.25e-8 PROSPERO
internal_repeat_1 518 731 1.22e-8 PROSPERO
GPS 1007 1056 3.62e-5 SMART
transmembrane domain 1075 1094 N/A INTRINSIC
LH2 1119 1238 1.01e-9 SMART
transmembrane domain 1282 1304 N/A INTRINSIC
transmembrane domain 1319 1341 N/A INTRINSIC
low complexity region 1398 1408 N/A INTRINSIC
low complexity region 1451 1460 N/A INTRINSIC
low complexity region 1484 1497 N/A INTRINSIC
transmembrane domain 1534 1556 N/A INTRINSIC
transmembrane domain 1576 1595 N/A INTRINSIC
Pfam:PKD_channel 1695 2110 2.8e-86 PFAM
Pfam:Ion_trans 1858 2114 2.9e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000109242
AA Change: T230P
SMART Domains Protein: ENSMUSP00000104865
Gene: ENSMUSG00000048827
AA Change: T230P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.63e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 440 3.96e-14 PROSPERO
internal_repeat_2 378 466 2.63e-8 PROSPERO
internal_repeat_1 518 724 3.96e-14 PROSPERO
GPS 1017 1066 3.62e-5 SMART
transmembrane domain 1085 1104 N/A INTRINSIC
LH2 1129 1248 1.01e-9 SMART
transmembrane domain 1292 1314 N/A INTRINSIC
transmembrane domain 1329 1351 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
low complexity region 1461 1470 N/A INTRINSIC
low complexity region 1494 1507 N/A INTRINSIC
transmembrane domain 1544 1566 N/A INTRINSIC
transmembrane domain 1586 1605 N/A INTRINSIC
Pfam:PKD_channel 1705 2120 1.3e-86 PFAM
Pfam:Ion_trans 1868 2124 4.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000212537
AA Change: T230P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212609
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal and exhibit normal taste responsiveness in various behavioral and electrophysiological tests of taste function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb5 T A 8: 54,550,575 V44E probably damaging Het
Bmpr2 T A 1: 59,868,344 D865E probably damaging Het
Ccr4 A G 9: 114,492,979 V6A probably benign Het
Cd209a A T 8: 3,747,031 D102E probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Cog4 T A 8: 110,880,894 I671N possibly damaging Het
Col14a1 T G 15: 55,445,822 probably benign Het
Cpne6 A G 14: 55,513,653 D173G probably damaging Het
Daglb G T 5: 143,481,651 V275L probably benign Het
Defb43 G T 14: 63,011,872 probably null Het
Dhx30 A G 9: 110,085,052 V1022A possibly damaging Het
Egfem1 A T 3: 29,657,163 K297M probably damaging Het
Egfr A G 11: 16,891,259 I717V probably benign Het
Eif2ak1 T G 5: 143,818,010 probably null Het
Epb42 T C 2: 121,027,133 Y307C possibly damaging Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fam185a A G 5: 21,425,283 D39G probably benign Het
Fbxl4 T A 4: 22,433,661 D599E probably damaging Het
Fgfr2 T A 7: 130,201,120 T268S probably benign Het
Gabra1 A T 11: 42,162,555 M84K probably benign Het
Gba A G 3: 89,205,928 D222G probably benign Het
Gm3409 T A 5: 146,537,786 H37Q possibly damaging Het
Gm4559 A G 7: 142,274,150 C72R unknown Het
Grik4 T C 9: 42,629,008 N292S probably benign Het
Haao A G 17: 83,831,684 S274P possibly damaging Het
Hsd17b4 T A 18: 50,172,262 probably null Het
Igdcc4 A T 9: 65,120,321 S222C probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itgb7 T A 15: 102,216,266 D772V probably benign Het
Kif14 T C 1: 136,527,411 L1607P probably damaging Het
Klf5 A G 14: 99,301,381 T77A probably benign Het
Klhl29 C T 12: 5,091,030 V605I probably damaging Het
Map4k1 T C 7: 28,987,022 V105A probably damaging Het
Mctp2 A T 7: 72,200,344 probably null Het
Med12l A G 3: 59,257,079 E1364G probably damaging Het
Mup9 A T 4: 60,419,806 D30E possibly damaging Het
Naip1 T C 13: 100,409,088 R1311G probably damaging Het
Olfr1306 G A 2: 111,912,859 Q24* probably null Het
Olfr56 C T 11: 49,134,933 T247I probably benign Het
Olfr706 A G 7: 106,886,397 V140A probably benign Het
Olfr945 T A 9: 39,258,082 M197L probably benign Het
Pthlh G T 6: 147,257,190 H91N probably damaging Het
Rapgef5 T A 12: 117,718,207 V239D probably damaging Het
Rita1 G A 5: 120,611,570 T26I probably damaging Het
Robo3 T C 9: 37,423,290 T615A probably damaging Het
Rpp38 T C 2: 3,329,607 D86G probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Senp2 G T 16: 22,023,800 V205L probably damaging Het
Sept10 T C 10: 59,192,311 N63D possibly damaging Het
Sez6 A G 11: 77,973,844 Het
Spesp1 C T 9: 62,272,433 V398I probably benign Het
Tmbim7 G A 5: 3,664,319 G19S probably benign Het
Tnni3k A T 3: 154,941,058 L431* probably null Het
Trdn T A 10: 33,464,555 probably null Het
Tubb2a A G 13: 34,075,459 V116A possibly damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Zfp768 A T 7: 127,344,655 F103L probably damaging Het
Zfp799 A G 17: 32,820,846 S149P probably damaging Het
Other mutations in Pkd1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pkd1l3 APN 8 109630237 missense possibly damaging 0.53
IGL00562:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL00563:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL01061:Pkd1l3 APN 8 109638706 missense probably damaging 1.00
IGL01105:Pkd1l3 APN 8 109662241 missense possibly damaging 0.81
IGL01574:Pkd1l3 APN 8 109623771 missense probably benign 0.01
IGL01597:Pkd1l3 APN 8 109623521 missense probably benign 0.33
IGL01634:Pkd1l3 APN 8 109667525 critical splice acceptor site probably null
IGL01645:Pkd1l3 APN 8 109635302 missense possibly damaging 0.59
IGL01770:Pkd1l3 APN 8 109648502 critical splice acceptor site probably null
IGL01837:Pkd1l3 APN 8 109630166 missense possibly damaging 0.85
IGL01862:Pkd1l3 APN 8 109631276 critical splice acceptor site probably null
IGL01938:Pkd1l3 APN 8 109635301 missense probably benign 0.00
IGL01990:Pkd1l3 APN 8 109660806 missense probably damaging 1.00
IGL02056:Pkd1l3 APN 8 109631378 missense probably benign 0.14
IGL02069:Pkd1l3 APN 8 109635380 missense probably damaging 1.00
IGL02086:Pkd1l3 APN 8 109665585 missense probably damaging 1.00
IGL02152:Pkd1l3 APN 8 109669292 missense probably damaging 1.00
IGL02209:Pkd1l3 APN 8 109638664 missense probably damaging 1.00
IGL02213:Pkd1l3 APN 8 109631345 missense probably damaging 1.00
IGL02218:Pkd1l3 APN 8 109660802 missense possibly damaging 0.92
IGL02225:Pkd1l3 APN 8 109638678 missense probably damaging 1.00
IGL02252:Pkd1l3 APN 8 109631076 missense possibly damaging 0.92
IGL02351:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02358:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02369:Pkd1l3 APN 8 109616345 missense unknown
IGL02481:Pkd1l3 APN 8 109614782 missense unknown
IGL02505:Pkd1l3 APN 8 109633216 missense probably damaging 1.00
IGL02506:Pkd1l3 APN 8 109647500 missense probably damaging 1.00
IGL02535:Pkd1l3 APN 8 109640890 nonsense probably null
IGL02715:Pkd1l3 APN 8 109626826 missense probably damaging 0.96
IGL02979:Pkd1l3 APN 8 109662104 splice site probably benign
IGL03059:Pkd1l3 APN 8 109648367 missense probably damaging 1.00
IGL03090:Pkd1l3 APN 8 109655533 nonsense probably null
IGL03206:Pkd1l3 APN 8 109623713 missense probably benign 0.18
IGL03328:Pkd1l3 APN 8 109662106 splice site probably benign
PIT4453001:Pkd1l3 UTSW 8 109660801 missense probably damaging 0.99
PIT4468001:Pkd1l3 UTSW 8 109664499 missense possibly damaging 0.85
R0001:Pkd1l3 UTSW 8 109628633 splice site probably benign
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0255:Pkd1l3 UTSW 8 109638754 missense probably damaging 1.00
R0288:Pkd1l3 UTSW 8 109646499 splice site probably null
R0311:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0311:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0403:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0403:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0441:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0446:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0466:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0467:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0468:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0515:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0534:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0650:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0689:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R1422:Pkd1l3 UTSW 8 109621708 missense unknown
R1464:Pkd1l3 UTSW 8 109636427 splice site probably benign
R1467:Pkd1l3 UTSW 8 109616368 missense unknown
R1467:Pkd1l3 UTSW 8 109616368 missense unknown
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1509:Pkd1l3 UTSW 8 109640770 missense probably damaging 0.99
R1561:Pkd1l3 UTSW 8 109614813 missense unknown
R1574:Pkd1l3 UTSW 8 109614813 missense unknown
R1599:Pkd1l3 UTSW 8 109636384 missense probably benign 0.01
R1688:Pkd1l3 UTSW 8 109623818 missense probably benign 0.18
R1792:Pkd1l3 UTSW 8 109632605 missense probably damaging 1.00
R1818:Pkd1l3 UTSW 8 109648406 missense probably benign 0.03
R1896:Pkd1l3 UTSW 8 109624199 missense possibly damaging 0.92
R2105:Pkd1l3 UTSW 8 109647573 nonsense probably null
R2185:Pkd1l3 UTSW 8 109633195 missense possibly damaging 0.95
R2192:Pkd1l3 UTSW 8 109620524 missense unknown
R2260:Pkd1l3 UTSW 8 109623636 missense probably benign 0.18
R2363:Pkd1l3 UTSW 8 109628709 missense probably benign 0.01
R2418:Pkd1l3 UTSW 8 109670721 makesense probably null
R2435:Pkd1l3 UTSW 8 109650702 missense probably benign 0.07
R2443:Pkd1l3 UTSW 8 109623815 missense probably benign 0.18
R2850:Pkd1l3 UTSW 8 109623990 missense possibly damaging 0.92
R2910:Pkd1l3 UTSW 8 109667636 splice site probably benign
R3755:Pkd1l3 UTSW 8 109632539 missense probably damaging 1.00
R3791:Pkd1l3 UTSW 8 109636317 missense probably damaging 0.99
R3905:Pkd1l3 UTSW 8 109646879 missense probably benign 0.02
R4027:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4028:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4029:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4274:Pkd1l3 UTSW 8 109624119 missense possibly damaging 0.92
R4461:Pkd1l3 UTSW 8 109632713 intron probably null
R4893:Pkd1l3 UTSW 8 109638394 missense probably benign 0.15
R4907:Pkd1l3 UTSW 8 109640843 missense probably damaging 0.99
R5037:Pkd1l3 UTSW 8 109665636 missense probably damaging 1.00
R5045:Pkd1l3 UTSW 8 109623155 missense unknown
R5207:Pkd1l3 UTSW 8 109633191 missense probably damaging 1.00
R5307:Pkd1l3 UTSW 8 109640792 missense probably damaging 1.00
R5408:Pkd1l3 UTSW 8 109667052 missense probably damaging 1.00
R5595:Pkd1l3 UTSW 8 109655520 missense probably damaging 1.00
R5615:Pkd1l3 UTSW 8 109630210 missense probably benign
R5623:Pkd1l3 UTSW 8 109623719 missense possibly damaging 0.53
R5896:Pkd1l3 UTSW 8 109626836 missense probably damaging 1.00
R6101:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6105:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6170:Pkd1l3 UTSW 8 109623179 missense unknown
R6330:Pkd1l3 UTSW 8 109646909 missense probably benign 0.00
R6346:Pkd1l3 UTSW 8 109631384 missense probably damaging 0.98
R6395:Pkd1l3 UTSW 8 109623963 missense probably benign 0.20
R6480:Pkd1l3 UTSW 8 109638387 nonsense probably null
R6519:Pkd1l3 UTSW 8 109628772 missense probably benign
R6654:Pkd1l3 UTSW 8 109624283 missense probably benign 0.23
R6717:Pkd1l3 UTSW 8 109614769 missense unknown
R6733:Pkd1l3 UTSW 8 109648494 splice site probably null
R6753:Pkd1l3 UTSW 8 109624449 missense probably damaging 1.00
R6777:Pkd1l3 UTSW 8 109626814 missense probably benign 0.00
R6901:Pkd1l3 UTSW 8 109614614 missense unknown
R6975:Pkd1l3 UTSW 8 109660907 missense possibly damaging 0.73
R6991:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7018:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7083:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7139:Pkd1l3 UTSW 8 109636340 missense probably damaging 0.96
R7153:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7235:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7238:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7252:Pkd1l3 UTSW 8 109660698 missense probably benign 0.01
R7296:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7309:Pkd1l3 UTSW 8 109648261 synonymous probably null
R7362:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7462:Pkd1l3 UTSW 8 109628777 missense probably benign 0.00
R7470:Pkd1l3 UTSW 8 109638376 missense probably benign 0.09
R7478:Pkd1l3 UTSW 8 109633315 missense probably damaging 1.00
R7483:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7516:Pkd1l3 UTSW 8 109635229 missense probably damaging 1.00
R7537:Pkd1l3 UTSW 8 109623788 small deletion probably benign
R7553:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7559:Pkd1l3 UTSW 8 109624440 missense probably benign 0.03
R7650:Pkd1l3 UTSW 8 109672585 missense probably benign 0.23
R7654:Pkd1l3 UTSW 8 109638417 missense probably damaging 1.00
R7742:Pkd1l3 UTSW 8 109614572 missense unknown
R7749:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7751:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7755:Pkd1l3 UTSW 8 109630166 missense possibly damaging 0.85
R7816:Pkd1l3 UTSW 8 109624195 small deletion probably benign
RF016:Pkd1l3 UTSW 8 109623542 missense probably benign 0.18
RF029:Pkd1l3 UTSW 8 109624195 small deletion probably benign
X0026:Pkd1l3 UTSW 8 109614553 missense probably null
Z31818:Pkd1l3 UTSW 8 109669292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGCGTTGTCCTCAGTGTG -3'
(R):5'- CTAGATGCAGATGTGGCTGATG -3'

Sequencing Primer
(F):5'- CAGTCTGTGTCCTAAAGAGCATG -3'
(R):5'- GGCTGATGTCACCTGTGG -3'
Posted On2018-05-21