Incidental Mutation 'R6475:Rapgef5'
ID517398
Institutional Source Beutler Lab
Gene Symbol Rapgef5
Ensembl Gene ENSMUSG00000041992
Gene NameRap guanine nucleotide exchange factor (GEF) 5
SynonymsD030051B22Rik, mr-gef
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6475 (G1)
Quality Score199.009
Status Validated
Chromosome12
Chromosomal Location117516479-117759737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117718207 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 239 (V239D)
Ref Sequence ENSEMBL: ENSMUSP00000152875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109691] [ENSMUST00000222105] [ENSMUST00000222185]
Predicted Effect probably damaging
Transcript: ENSMUST00000109691
AA Change: V441D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105313
Gene: ENSMUSG00000041992
AA Change: V441D

DomainStartEndE-ValueType
DEP 44 118 2.07e-12 SMART
RasGEFN 300 434 3.12e-34 SMART
Blast:RasGEF 441 502 7e-31 BLAST
RasGEF 574 814 1.52e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222105
AA Change: V239D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222185
AA Change: V207D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223040
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF5, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb5 T A 8: 54,550,575 V44E probably damaging Het
Bmpr2 T A 1: 59,868,344 D865E probably damaging Het
Ccr4 A G 9: 114,492,979 V6A probably benign Het
Cd209a A T 8: 3,747,031 D102E probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Cog4 T A 8: 110,880,894 I671N possibly damaging Het
Col14a1 T G 15: 55,445,822 probably benign Het
Cpne6 A G 14: 55,513,653 D173G probably damaging Het
Daglb G T 5: 143,481,651 V275L probably benign Het
Defb43 G T 14: 63,011,872 probably null Het
Dhx30 A G 9: 110,085,052 V1022A possibly damaging Het
Egfem1 A T 3: 29,657,163 K297M probably damaging Het
Egfr A G 11: 16,891,259 I717V probably benign Het
Eif2ak1 T G 5: 143,818,010 probably null Het
Epb42 T C 2: 121,027,133 Y307C possibly damaging Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fam185a A G 5: 21,425,283 D39G probably benign Het
Fbxl4 T A 4: 22,433,661 D599E probably damaging Het
Fgfr2 T A 7: 130,201,120 T268S probably benign Het
Gabra1 A T 11: 42,162,555 M84K probably benign Het
Gba A G 3: 89,205,928 D222G probably benign Het
Gm3409 T A 5: 146,537,786 H37Q possibly damaging Het
Gm4559 A G 7: 142,274,150 C72R unknown Het
Grik4 T C 9: 42,629,008 N292S probably benign Het
Haao A G 17: 83,831,684 S274P possibly damaging Het
Hsd17b4 T A 18: 50,172,262 probably null Het
Igdcc4 A T 9: 65,120,321 S222C probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itgb7 T A 15: 102,216,266 D772V probably benign Het
Kif14 T C 1: 136,527,411 L1607P probably damaging Het
Klf5 A G 14: 99,301,381 T77A probably benign Het
Klhl29 C T 12: 5,091,030 V605I probably damaging Het
Map4k1 T C 7: 28,987,022 V105A probably damaging Het
Mctp2 A T 7: 72,200,344 probably null Het
Med12l A G 3: 59,257,079 E1364G probably damaging Het
Mup9 A T 4: 60,419,806 D30E possibly damaging Het
Naip1 T C 13: 100,409,088 R1311G probably damaging Het
Olfr1306 G A 2: 111,912,859 Q24* probably null Het
Olfr56 C T 11: 49,134,933 T247I probably benign Het
Olfr706 A G 7: 106,886,397 V140A probably benign Het
Olfr945 T A 9: 39,258,082 M197L probably benign Het
Pkd1l3 A C 8: 109,623,212 T230P unknown Het
Pthlh G T 6: 147,257,190 H91N probably damaging Het
Rita1 G A 5: 120,611,570 T26I probably damaging Het
Robo3 T C 9: 37,423,290 T615A probably damaging Het
Rpp38 T C 2: 3,329,607 D86G probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Senp2 G T 16: 22,023,800 V205L probably damaging Het
Sept10 T C 10: 59,192,311 N63D possibly damaging Het
Sez6 A G 11: 77,973,844 Het
Spesp1 C T 9: 62,272,433 V398I probably benign Het
Tmbim7 G A 5: 3,664,319 G19S probably benign Het
Tnni3k A T 3: 154,941,058 L431* probably null Het
Trdn T A 10: 33,464,555 probably null Het
Tubb2a A G 13: 34,075,459 V116A possibly damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Zfp768 A T 7: 127,344,655 F103L probably damaging Het
Zfp799 A G 17: 32,820,846 S149P probably damaging Het
Other mutations in Rapgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Rapgef5 APN 12 117714182 missense probably damaging 0.99
IGL01405:Rapgef5 APN 12 117721380 missense probably benign 0.16
IGL01611:Rapgef5 APN 12 117753419 splice site probably benign
IGL01720:Rapgef5 APN 12 117613435 splice site probably benign
IGL01958:Rapgef5 APN 12 117730651 missense probably benign 0.24
IGL02093:Rapgef5 APN 12 117719132 missense probably damaging 0.98
IGL03210:Rapgef5 APN 12 117742872 missense probably damaging 1.00
IGL03370:Rapgef5 APN 12 117730559 missense probably damaging 1.00
IGL03397:Rapgef5 APN 12 117748441 missense probably damaging 1.00
R0026:Rapgef5 UTSW 12 117689161 missense probably benign 0.11
R0026:Rapgef5 UTSW 12 117689161 missense probably benign 0.11
R0100:Rapgef5 UTSW 12 117721299 missense probably benign 0.05
R0173:Rapgef5 UTSW 12 117688676 missense probably benign 0.00
R0834:Rapgef5 UTSW 12 117647121 splice site probably benign
R1331:Rapgef5 UTSW 12 117721349 missense probably benign 0.04
R1505:Rapgef5 UTSW 12 117688619 missense possibly damaging 0.92
R1546:Rapgef5 UTSW 12 117647101 missense probably benign 0.00
R1577:Rapgef5 UTSW 12 117595291 missense probably benign 0.28
R1597:Rapgef5 UTSW 12 117658320 missense probably damaging 1.00
R1824:Rapgef5 UTSW 12 117688684 critical splice donor site probably null
R2065:Rapgef5 UTSW 12 117584119 nonsense probably null
R2117:Rapgef5 UTSW 12 117714064 intron probably null
R2169:Rapgef5 UTSW 12 117715395 missense probably benign 0.25
R2903:Rapgef5 UTSW 12 117714119 missense probably damaging 1.00
R3983:Rapgef5 UTSW 12 117728670 missense possibly damaging 0.49
R4004:Rapgef5 UTSW 12 117748397 missense probably damaging 0.99
R4652:Rapgef5 UTSW 12 117714128 missense probably damaging 0.99
R4830:Rapgef5 UTSW 12 117756074 missense probably damaging 1.00
R5282:Rapgef5 UTSW 12 117739644 missense probably damaging 1.00
R5348:Rapgef5 UTSW 12 117688611 missense probably benign 0.24
R5456:Rapgef5 UTSW 12 117728646 splice site probably null
R5502:Rapgef5 UTSW 12 117721329 missense probably damaging 1.00
R5741:Rapgef5 UTSW 12 117756029 missense probably damaging 0.99
R5771:Rapgef5 UTSW 12 117721326 missense probably benign 0.45
R5905:Rapgef5 UTSW 12 117748426 missense probably damaging 1.00
R5941:Rapgef5 UTSW 12 117728738 missense probably damaging 1.00
R6228:Rapgef5 UTSW 12 117721663 intron probably null
R6233:Rapgef5 UTSW 12 117739718 critical splice donor site probably null
R6376:Rapgef5 UTSW 12 117721253 missense probably damaging 1.00
R7063:Rapgef5 UTSW 12 117689129 missense possibly damaging 0.91
R7410:Rapgef5 UTSW 12 117721328 missense probably damaging 1.00
R7445:Rapgef5 UTSW 12 117755969 missense probably benign 0.00
R7690:Rapgef5 UTSW 12 117721370 missense possibly damaging 0.72
R7707:Rapgef5 UTSW 12 117715344 missense probably damaging 1.00
R7815:Rapgef5 UTSW 12 117755967 missense probably benign 0.10
X0018:Rapgef5 UTSW 12 117718215 missense probably damaging 1.00
Z1176:Rapgef5 UTSW 12 117595288 missense probably damaging 1.00
Z1177:Rapgef5 UTSW 12 117688997 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCACAGTGACAGATGCATT -3'
(R):5'- GGAAAGTGCAGGCCAGCTG -3'

Sequencing Primer
(F):5'- GCACCACTGTACCAGAGTTATTTTG -3'
(R):5'- AGCTGCATCCCTGGATTTC -3'
Posted On2018-05-21